G1678726



Basic Information


Item Value
gene id G1678726
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 26112284 ~ 26112543 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1920444
atctgtacaaacaatagtatgcaagtataaacaccatgggaccacgtagccgtcataccgctcaggaaggagaagcgttctgtctcctagagattaacgtattttggtgcgaaaagtgcaaatcaatcccagaacaacagcaaaggaccttgtgaagatgctgaaggaaacaggtacaaaagtatctatatccacagtaaaacgagtcctatatcgacataacctgaaaggccgctcagcaaggaagaagccactgctcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1920444 True 260 lncRNA 0.44 1 26112284 26112543
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499245 LOC106589628 coding downstream 193848 25841005 ~ 25918436 (-)
hs3st3b1b LOC106589627 coding downstream 275954 25807975 ~ 25836330 (-)
LOC118942473 NA coding downstream 506862 25605370 ~ 25605422 (-)
tekt3 tekt3 coding downstream 622655 25459179 ~ 25489629 (-)
pmp22b pmp22 coding downstream 667159 25430442 ~ 25445125 (-)
fbxw10 cdrt1 coding upstream 95989 26208532 ~ 26229024 (-)
trnag-ccc-5 NA coding upstream 117333 26229876 ~ 26229946 (-)
LOC110499248 LOC100380747 coding upstream 122367 26234910 ~ 26261384 (-)
col1a1b col1a3 coding upstream 163611 26276154 ~ 26298481 (-)
si:ch1073-13h15.3 LOC107387676 coding upstream 247647 26360190 ~ 26365511 (-)
G1678710 NA non-coding downstream 9042 26102760 ~ 26103242 (-)
G1678704 LOC106613431 non-coding downstream 13144 26098724 ~ 26099140 (-)
G1678695 NA non-coding downstream 21382 26090679 ~ 26090902 (-)
G1678623 NA non-coding downstream 45023 25972564 ~ 26067261 (-)
G1678517 NA non-coding downstream 319037 25792945 ~ 25793247 (-)
G1678754 NA non-coding upstream 18308 26130851 ~ 26131124 (-)
G1679340 NA non-coding upstream 117634 26230177 ~ 26230925 (-)
G1679346 LOC105030512 non-coding upstream 128756 26241299 ~ 26241615 (-)
G1679363 NA non-coding upstream 149561 26262104 ~ 26263203 (-)
G1678462 NA other downstream 407160 25704621 ~ 25705124 (-)
G1678242 cdc42ep4 other downstream 719708 25387881 ~ 25392576 (-)
G1677008 NA other downstream 1401786 24710125 ~ 24710498 (-)
G1676904 NA other downstream 1473583 24638343 ~ 24638701 (-)
rpl38 NA other downstream 1702765 24407459 ~ 24412883 (-)
G1680017 NA other upstream 932239 27044782 ~ 27045294 (-)
G1680171 cog2 other upstream 1168280 27280823 ~ 27283995 (-)
sf3b5 sf3b5 other upstream 1269442 27381985 ~ 27384608 (-)

Expression


G1678726 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1678726 Expression in each Bioproject

Bar chart with 20 bars.
G1678726 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network