G1679346 (LOC105030512)



Basic Information


Item Value
gene id G1679346
gene name LOC105030512
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 26241299 ~ 26241615 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1921118
tactgtgagacgcctaagacagcgctacagggagacagggcggacagctgattgtcctcgcagtggcagaccacatgtaacatcacctgcacaggatcggtacatccgaacatcacacctgcgggacaggtacaggatggcaacaacaactgcctgagttacaccagaaacgcacaatccctccatcagtgctcagactgtccacaataggctgagaggctggactgaaggtcctcaccagacatcaccagcaacaactttgcctatgggcacaaacccaccgtcactggacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1921118 True 293 lncRNA 0.55 2 26241299 26241615
Loading

Neighbor


gene id symbol gene type direction distance location
trnag-ccc-5 NA coding downstream 11353 26229876 ~ 26229946 (-)
fbxw10 cdrt1 coding downstream 12275 26208532 ~ 26229024 (-)
LOC110499245 LOC106589628 coding downstream 322863 25841005 ~ 25918436 (-)
hs3st3b1b LOC106589627 coding downstream 404969 25807975 ~ 25836330 (-)
LOC118942473 NA coding downstream 635877 25605370 ~ 25605422 (-)
col1a1b col1a3 coding upstream 34539 26276154 ~ 26298481 (-)
si:ch1073-13h15.3 LOC107387676 coding upstream 118575 26360190 ~ 26365511 (-)
gngt2b NA coding upstream 132028 26373643 ~ 26383422 (-)
lsm12b lsm12 coding upstream 158522 26400137 ~ 26404966 (-)
tanc2b LOC106589639 coding upstream 167858 26409473 ~ 26629846 (-)
G1679340 NA non-coding downstream 10374 26230177 ~ 26230925 (-)
G1678754 NA non-coding downstream 110175 26130851 ~ 26131124 (-)
G1678726 NA non-coding downstream 128756 26112284 ~ 26112543 (-)
G1678710 NA non-coding downstream 138057 26102760 ~ 26103242 (-)
G1679363 NA non-coding upstream 20489 26262104 ~ 26263203 (-)
G1679384 NA non-coding upstream 70393 26312008 ~ 26312245 (-)
G1679397 NA non-coding upstream 88887 26330502 ~ 26330793 (-)
G1679402 NA non-coding upstream 96966 26338581 ~ 26338828 (-)
G1679403 NA non-coding upstream 98963 26340578 ~ 26340949 (-)
G1678462 NA other downstream 536175 25704621 ~ 25705124 (-)
G1678242 cdc42ep4 other downstream 848723 25387881 ~ 25392576 (-)
G1677008 NA other downstream 1530801 24710125 ~ 24710498 (-)
G1676904 NA other downstream 1602598 24638343 ~ 24638701 (-)
G1680017 NA other upstream 803167 27044782 ~ 27045294 (-)
G1680171 cog2 other upstream 1039208 27280823 ~ 27283995 (-)
sf3b5 sf3b5 other upstream 1140370 27381985 ~ 27384608 (-)
LOC110499285 olig3 other upstream 1507938 27748849 ~ 27750461 (-)

Expression


G1679346(LOC105030512) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1679346(LOC105030512) Expression in each Bioproject

Bar chart with 21 bars.
G1679346(LOC105030512) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network