G1680392



Basic Information


Item Value
gene id G1680392
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 27633695 ~ 27634069 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1922266
gccagggactcaaatcctgcagtgccagacatgtccccctgcttaagccagtacatgtccaggcctgtctgaagtttgctagagagcatttggatgatccagaagaagattgggagaatgtcatatggtcagatgaaaccaaaataaaactttttggtaaaaactcaactcgtcgtgtttggaggacaaagaatgctgagttgcatccaaagaacaccatacctactgtgaagcatgggggtggaaacatcatgctttggggctgtttttctgcaaagggaccaggacgactgatccgtgtaaaggaaagaatgaatggggccatgtatcgtgagattttgagtgaaaacctccttccatcagcaagggcattga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1922266 True 375 lncRNA 0.46 1 27633695 27634069
Loading

Neighbor


gene id symbol gene type direction distance location
map3k21 LOC106589668 coding upstream 6910 27610623 ~ 27626785 (+)
rgs17 LOC106589666 coding upstream 99211 27494428 ~ 27534484 (+)
phactr2 LOC106589662 coding upstream 269592 27307243 ~ 27364103 (+)
cog2 cog2 coding upstream 341603 27280844 ~ 27292092 (+)
galnt2 LOC106589660 coding upstream 391839 27149393 ~ 27241856 (+)
LOC110499283 LOC106589675 coding downstream 42524 27676593 ~ 27683907 (+)
LOC100136337 tnfaip3 coding downstream 136673 27770742 ~ 27786519 (+)
arfgef3 arfgef3 coding downstream 180320 27814389 ~ 27858095 (+)
lhb LOC100135809 coding downstream 230799 27864868 ~ 27866512 (+)
adss2 LOC106589688 coding downstream 309698 27943767 ~ 27969322 (+)
G1680391 NA non-coding upstream 91 27633242 ~ 27633604 (+)
G1680228 sf3b5 non-coding upstream 249094 27381986 ~ 27384601 (+)
G1679967 NA non-coding upstream 318103 27315294 ~ 27315592 (+)
G1679957 NA non-coding upstream 332174 27301202 ~ 27301521 (+)
G1679956 NA non-coding upstream 332620 27300810 ~ 27301075 (+)
G1680393 NA non-coding downstream 582 27634651 ~ 27635105 (+)
G1680394 NA non-coding downstream 1732 27635801 ~ 27636483 (+)
G1680395 NA non-coding downstream 5270 27639339 ~ 27639804 (+)
G1680411 NA non-coding downstream 32312 27666381 ~ 27666624 (+)
G1680412 NA non-coding downstream 32703 27666772 ~ 27667080 (+)
G1680230 NA other upstream 257876 27375354 ~ 27375819 (+)
G1679823 NA other upstream 546232 27084426 ~ 27087463 (+)
G1679135 NA other upstream 858015 26700392 ~ 26775680 (+)
LOC110499259 LOC106589644 other upstream 977584 26654584 ~ 26656111 (+)
LOC110499256 LOC106589642 other upstream 1000497 26632095 ~ 26639269 (+)
G1681180 NA other downstream 1083292 28717361 ~ 28726495 (+)
G1681792 NA other downstream 1143937 28778006 ~ 28778409 (+)
lhcgr lhr other downstream 1823159 29437357 ~ 29458499 (+)
LOC110499316 LOC106589729 other downstream 1938366 29572397 ~ 29588171 (+)
G1686317 LOC106589755 other downstream 5020285 32654354 ~ 32661648 (+)

Expression


G1680392 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1680392 Expression in each Bioproject

Bar chart with 21 bars.
G1680392 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network