G1680964



Basic Information


Item Value
gene id G1680964
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 28255216 ~ 28255554 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1922886
gacacaaatattaattttcacaaagtttgctgcttcagtgtctttagatatttttgtcagatgttactatggaatactgaagtataattacaagcatttcataagtgtcaaaggcttttattgacaattacatgaagttgatacaaagagtcaatatttgcagtgttgacccttctttttcaagacctctgaaatccgccctggcatgctgtcaattaacttctgggccacatcctgactgatggcagcccattcttgcataatcaatgattggagtttgtcagaatttgtgggtttttgtttgtccacccgcctcttgaggattgaccacaagttctc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1922886 True 339 lncRNA 0.38 1 28255216 28255554
Loading

Neighbor


gene id symbol gene type direction distance location
akt3a LOC106589689 coding upstream 85444 28027289 ~ 28169772 (+)
adss2 LOC106589688 coding upstream 285894 27943767 ~ 27969322 (+)
lhb LOC100135809 coding upstream 388704 27864868 ~ 27866512 (+)
arfgef3 arfgef3 coding upstream 397121 27814389 ~ 27858095 (+)
LOC100136337 tnfaip3 coding upstream 468697 27770742 ~ 27786519 (+)
abcg8 abcg8 coding downstream 60935 28316489 ~ 28331818 (+)
ppm1ba ppm1b coding downstream 223246 28478800 ~ 28525093 (+)
slc3a1 slc3a1 coding downstream 269915 28525469 ~ 28534588 (+)
camkmt camkmt coding downstream 292939 28548493 ~ 28745581 (+)
six3a six3 coding downstream 593497 28849051 ~ 28852328 (+)
cep170aa cep170 non-coding upstream 6249 28225910 ~ 28293688 (+)
G1680874 NA non-coding upstream 155646 28098477 ~ 28099570 (+)
G1680826 NA non-coding upstream 228399 28026511 ~ 28026817 (+)
G1680704 NA non-coding upstream 263160 27991571 ~ 27992056 (+)
G1680780 NA non-coding upstream 317519 27937194 ~ 27937697 (+)
G1680968 NA non-coding downstream 5541 28261095 ~ 28261302 (+)
G1680969 NA non-coding downstream 6283 28261837 ~ 28262116 (+)
G1680975 NA non-coding downstream 20552 28276106 ~ 28276823 (+)
G1680703 NA non-coding downstream 43789 28299343 ~ 28301581 (+)
G1681025 NA non-coding downstream 152525 28408079 ~ 28408380 (+)
G1680230 NA other upstream 879397 27375354 ~ 27375819 (+)
G1679823 NA other upstream 1167753 27084426 ~ 27087463 (+)
G1679135 NA other upstream 1479536 26700392 ~ 26775680 (+)
LOC110499259 LOC106589644 other upstream 1599105 26654584 ~ 26656111 (+)
LOC110499256 LOC106589642 other upstream 1622018 26632095 ~ 26639269 (+)
G1681180 NA other downstream 461807 28717361 ~ 28726495 (+)
G1681792 NA other downstream 522452 28778006 ~ 28778409 (+)
lhcgr lhr other downstream 1201674 29437357 ~ 29458499 (+)
LOC110499316 LOC106589729 other downstream 1316881 29572397 ~ 29588171 (+)
G1686317 LOC106589755 other downstream 4398800 32654354 ~ 32661648 (+)

Expression


G1680964 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1680964 Expression in each Bioproject

Bar chart with 21 bars.
G1680964 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network