G1683904



Basic Information


Item Value
gene id G1683904
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 30584797 ~ 30585016 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1926128
gtatggacctcactttgtgcatgggggcattgtcatgctgaaactggaaagggccttccccaaactgttgccacaacgttggaagcacagaatcatctagaatgtcattgtatccagtagcgttaagatttcccttcactggaacaaaggggcttagcccaaaccatgaaaaacagcccaagaccattattcctcctccaacaatctttacagttggcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1926128 True 220 lncRNA 0.46 1 30584797 30585016
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498786 LOC106589743 coding downstream 275533 30271979 ~ 30309264 (-)
foxn2a foxn2 coding downstream 426147 30108682 ~ 30158650 (-)
fbxo11a fbxo11 coding downstream 491083 30060126 ~ 30093714 (-)
golga4 golga4 coding downstream 782960 29747225 ~ 29801837 (-)
itga9 LOC106589731 coding downstream 838469 29606706 ~ 29746328 (-)
LOC110498787 nrxn1 coding upstream 23550 30608566 ~ 31165271 (-)
LOC110499326 LOC106589746 coding upstream 1149840 31734856 ~ 31806658 (-)
LOC110499330 LOC106589750 coding upstream 1558493 32143509 ~ 32226222 (-)
LOC110499332 LOC106588150 coding upstream 1569921 32154937 ~ 32158796 (-)
LOC118942460 NA coding upstream 1917113 32502129 ~ 32502308 (-)
G1683899 NA non-coding downstream 1763 30582817 ~ 30583034 (-)
G1683890 NA non-coding downstream 5760 30578787 ~ 30579037 (-)
G1683868 NA non-coding downstream 23259 30561332 ~ 30561538 (-)
G1683861 NA non-coding downstream 26181 30558404 ~ 30558616 (-)
G1683815 NA non-coding downstream 52919 30531660 ~ 30531878 (-)
G1684390 NA non-coding upstream 52266 30637282 ~ 30637712 (-)
G1684504 NA non-coding upstream 240783 30825799 ~ 30827619 (-)
G1684507 NA non-coding upstream 250619 30835635 ~ 30836013 (-)
G1684526 NA non-coding upstream 291494 30876510 ~ 30876803 (-)
G1684565 NA non-coding upstream 351617 30936633 ~ 30956023 (-)
LOC110499315 LOC106589727 other downstream 1038480 29541315 ~ 29571033 (-)
G1681658 NA other downstream 2048988 28535295 ~ 28535809 (-)
G1681623 NA other downstream 2110772 28473285 ~ 28474025 (-)
fa36a fa36a other downstream 2719969 27860741 ~ 27864828 (-)
LOC110499285 olig3 other downstream 2834367 27748849 ~ 27750461 (-)
G1684661 NA other upstream 526539 31111555 ~ 31113686 (-)
G1684920 NA other upstream 822578 31407594 ~ 31412844 (-)
LOC110499342 LOC106589762 other upstream 2226691 32810995 ~ 32812999 (-)
G1686887 NA other upstream 2492794 33077810 ~ 33078027 (-)
LOC110499358 LOC106589782 other upstream 2948657 33530945 ~ 33535225 (-)

Expression


G1683904 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1683904 Expression in each Bioproject

Bar chart with 19 bars.
G1683904 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network