G1686272



Basic Information


Item Value
gene id G1686272
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 32587107 ~ 32587532 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1928756
caataactggaacgaattgcaaaaatcattgaatttgaagacatatctccctcactaactttaagcgtcagctgtcagagcagcttaccgatccctgcagctgtacacagcccatctgtaaatagcccatccaaccaactacctacctcatccccatatttgttttctgctcttttgcacaccagtatttctacttgcacatcctcatctgcacatatatcactccagtgtaaattgctaaattgtaattacttcgccactattggcctatttattgccttacctccttacttcattttgcacacactgtatacagatttgactattgtgttattgactgtacgtttgtttatcccatgtgtaactctgtgttgttgtttttgtcgcactgctttgctttatcttggacaggtcgcagttgtaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1928756 True 426 lncRNA 0.40 1 32587107 32587532

Neighbor


gene id symbol gene type direction distance location
LOC110499334 LOC106589753 coding upstream 110942 32291265 ~ 32476165 (+)
kcnk1b kcnk1 coding upstream 324930 32245903 ~ 32262177 (+)
agpat4 LOC106589751 coding upstream 443643 32123986 ~ 32144750 (+)
thbs2a thbs2 coding upstream 514019 32034199 ~ 32073088 (+)
wdr27 wdr27 coding upstream 609033 31822760 ~ 31978074 (+)
LOC110499531 NA coding downstream 25426 32612958 ~ 32613933 (+)
LOC110499339 LOC106589759 coding downstream 102555 32690087 ~ 32702525 (+)
LOC110499338 LOC106589757 coding downstream 115259 32702791 ~ 32736730 (+)
LOC110499341 LOC106589760 coding downstream 160059 32747591 ~ 32760047 (+)
LOC110499344 LOC106589763 coding downstream 262165 32849697 ~ 32863389 (+)
G1686268 NA non-coding upstream 5226 32581536 ~ 32581881 (+)
G1686256 NA non-coding upstream 29678 32557209 ~ 32557429 (+)
G1685830 NA non-coding upstream 46493 32540182 ~ 32540614 (+)
G1685807 NA non-coding upstream 85236 32501659 ~ 32501871 (+)
G1685805 NA non-coding upstream 88092 32498807 ~ 32499015 (+)
G1686274 NA non-coding downstream 3377 32590909 ~ 32591522 (+)
G1686292 NA non-coding downstream 33745 32621277 ~ 32621527 (+)
G1686294 NA non-coding downstream 36730 32624262 ~ 32624464 (+)
G1686296 NA non-coding downstream 39000 32626532 ~ 32626835 (+)
G1686302 NA non-coding downstream 53956 32641488 ~ 32641702 (+)
LOC110499316 LOC106589729 other upstream 3010549 29572397 ~ 29588171 (+)
lhcgr lhr other upstream 3129186 29437357 ~ 29458499 (+)
G1681792 NA other upstream 3808698 28778006 ~ 28778409 (+)
G1681180 NA other upstream 3860612 28717361 ~ 28726495 (+)
G1680230 NA other upstream 5211288 27375354 ~ 27375819 (+)
G1686317 LOC106589755 other downstream 66822 32654354 ~ 32661648 (+)
LOC118942060 LOC106589768 other downstream 589761 33177293 ~ 33196167 (+)
G1687675 NA other downstream 1738305 34325837 ~ 34326254 (+)
LOC110499396 LOC106589821 other downstream 2794177 35381609 ~ 35384567 (+)
G1689347 NA other downstream 3093835 35681367 ~ 35682437 (+)

Expression


G1686272 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1686272 Expression in each Bioproject

Bar chart with 20 bars.
G1686272 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network