G1687188



Basic Information


Item Value
gene id G1687188
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 33659402 ~ 33659854 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1929835
cttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatattgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatgttgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcatctcatacaaggagaagactgatcagaga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1929835 True 453 lncRNA 0.41 1 33659402 33659854

Neighbor


gene id symbol gene type direction distance location
LOC118942063 NA coding upstream 129923 33528620 ~ 33530380 (+)
LOC110499354 NA coding upstream 141959 33474940 ~ 33517443 (+)
LOC110499352 LOC106589767 coding upstream 397268 33216272 ~ 33262134 (+)
LOC118942060 LOC106589768 coding upstream 463235 33177293 ~ 33196167 (+)
LOC110499532 hpse2 coding upstream 526577 33063035 ~ 33132825 (+)
LOC110499362 LOC106589783 coding downstream 1467 33661321 ~ 33787514 (+)
rab23 LOC106589799 coding downstream 289898 33949752 ~ 33958728 (+)
LOC110499368 LOC106589788 coding downstream 324612 33984466 ~ 34178931 (+)
zmp:0000000760 LOC106589800 coding downstream 524226 34184080 ~ 34208986 (+)
col21a1 LOC106589801 coding downstream 566017 34225871 ~ 34271548 (+)
G1687156 NA non-coding upstream 22046 33637138 ~ 33637356 (+)
G1687142 NA non-coding upstream 33238 33625941 ~ 33626164 (+)
G1687114 NA non-coding upstream 53747 33605238 ~ 33605655 (+)
G1686753 LOC106589781 non-coding upstream 100383 33533679 ~ 33559019 (+)
G1687212 NA non-coding downstream 29581 33689435 ~ 33689903 (+)
G1687439 NA non-coding downstream 194784 33854638 ~ 33854910 (+)
G1687456 NA non-coding downstream 203282 33863136 ~ 33863392 (+)
G1687463 NA non-coding downstream 208963 33868817 ~ 33869241 (+)
G1687496 NA non-coding downstream 235880 33895734 ~ 33895971 (+)
G1686317 LOC106589755 other upstream 997754 32654354 ~ 32661648 (+)
LOC110499316 LOC106589729 other upstream 4082844 29572397 ~ 29588171 (+)
lhcgr lhr other upstream 4201481 29437357 ~ 29458499 (+)
G1681792 NA other upstream 4880993 28778006 ~ 28778409 (+)
G1687675 NA other downstream 665983 34325837 ~ 34326254 (+)
LOC110499396 LOC106589821 other downstream 1721855 35381609 ~ 35384567 (+)
G1689347 NA other downstream 2021513 35681367 ~ 35682437 (+)
LOC118942012 LOC106589797 other downstream 2041366 35701200 ~ 35702156 (+)
G1689671 NA other downstream 2221724 35881578 ~ 35881874 (+)

Expression


G1687188 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1687188 Expression in each Bioproject

Bar chart with 20 bars.
G1687188 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network