G1692348



Basic Information


Item Value
gene id G1692348
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 38502356 ~ 38502732 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1935620
gttgagaacacctttatttaaccaggtaggccagttgagaacacctttatttaaccaggtaggccagttgaaaacacctttatttaaccaggtaggccagttgagaacacctttatttaaccaggtaggctagttgagaacacctttatttaaccaggtaggccagttgagaacacctttatttaaccaggtaggccagttgagaacacctt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1935620 True 212 lncRNA 0.42 2 38502356 38502732

Neighbor


gene id symbol gene type direction distance location
oxld1 LOC106589895 coding downstream 10245 38489508 ~ 38492111 (-)
LOC110499454 cnrg coding downstream 16946 38482976 ~ 38485410 (-)
LOC110499543 LOC106589896 coding downstream 23405 38445288 ~ 38478951 (-)
LOC110499450 LOC106589897 coding downstream 89910 38402819 ~ 38412446 (-)
rtst6galnac rtst6galnac coding downstream 143615 38342990 ~ 38358741 (-)
LOC110499451 LOC106589894 coding upstream 12870 38515602 ~ 38527974 (-)
LOC110499599 NA coding upstream 35107 38537839 ~ 38545503 (-)
kcnj2a LOC106589892 coding upstream 251025 38753757 ~ 38762601 (-)
LOC110499456 LOC106589891 coding upstream 279295 38782027 ~ 38801044 (-)
tvp23b LOC106589890 coding upstream 462856 38965588 ~ 38972051 (-)
G1692345 NA non-coding downstream 2066 38499959 ~ 38500290 (-)
G1692340 NA non-coding downstream 15328 38486749 ~ 38487028 (-)
G1692288 cnrg non-coding downstream 16994 38478761 ~ 38485362 (-)
G1692301 NA non-coding downstream 116485 38385331 ~ 38385871 (-)
G1692295 NA non-coding downstream 127613 38374450 ~ 38374743 (-)
G1692371 NA non-coding upstream 32633 38535365 ~ 38535565 (-)
G1692383 NA non-coding upstream 44287 38547019 ~ 38547248 (-)
G1692388 NA non-coding upstream 48726 38551458 ~ 38551761 (-)
G1692391 NA non-coding upstream 53099 38555831 ~ 38556033 (-)
G1692409 NA non-coding upstream 67685 38570417 ~ 38570618 (-)
G1691432 NA other downstream 1263046 37238827 ~ 37239310 (-)
LOC110499438 LOC106589865 other downstream 1606150 36891846 ~ 36896982 (-)
G1690696 NA other downstream 1692213 36809699 ~ 36810143 (-)
G1692405 NA other upstream 64648 38567380 ~ 38568189 (-)
LOC110499457 LOC106589889 other upstream 501068 38982955 ~ 39006598 (-)
LOC110499545 hid1 other upstream 571346 39070043 ~ 39101170 (-)
G1693092 NA other upstream 761569 39264301 ~ 39264691 (-)
G1693393 NA other upstream 960698 39463430 ~ 39490078 (-)

Expression


G1692348 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1692348 Expression in each Bioproject

Bar chart with 17 bars.
G1692348 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network