G1696541



Basic Information


Item Value
gene id G1696541
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 43133627 ~ 43134013 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1940630
tcgagggaaagatgaacggagcaaagtacagagagatccttgatgaaaacatgctccagagcgctcaggacctcagactggggcaaaggttcaccttccaacaggacaacgaccttaagcacacagccaagacaactcaggagtggctttgggacaagtctctgaatgtccttgagtggcacagtcagagcccagacttgaactcgatagaacatctctggagagacctgaaaataactgtgcagcgacgctccccatcgaacctgacagagcttgagaggatctgcagagaagaatgggagaaactccccaaatacaggtgtgccaagcttgtagtgtcatacccaagactgaaggctgtaattgctgccaaaggtgcttcaacaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1940630 True 387 TUCP 0.50 1 43133627 43134013
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499502 pde10a coding upstream 11732 42950949 ~ 43125594 (+)
tbxtb LOC106589941 coding upstream 281888 42846046 ~ 42851739 (+)
LOC118942075 NA coding upstream 306535 42803589 ~ 42827234 (+)
LOC110499501 sft2a coding upstream 359518 42745164 ~ 42774109 (+)
LOC110499499 LOC106589923 coding upstream 473617 42655757 ~ 42660010 (+)
LOC110499564 NA coding downstream 3375 43137388 ~ 43148369 (+)
LOC110510394 NA coding downstream 237680 43371693 ~ 43402764 (+)
LOC118942021 micu1 coding downstream 314701 43448714 ~ 43494181 (+)
LOC110499505 LOC106589952 coding downstream 464074 43552789 ~ 43615700 (+)
LOC110499517 LOC106589992 coding downstream 843267 43977280 ~ 43987101 (+)
G1696432 NA non-coding upstream 5627 43125707 ~ 43128000 (+)
G1696529 NA non-coding upstream 22558 43107649 ~ 43111069 (+)
G1696528 NA non-coding upstream 23786 43106753 ~ 43109841 (+)
G1696526 NA non-coding upstream 26952 43100523 ~ 43106675 (+)
G1696542 NA non-coding downstream 148 43134161 ~ 43134694 (+)
G1696431 NA non-coding downstream 16591 43150604 ~ 43155908 (+)
G1696549 NA non-coding downstream 23800 43157813 ~ 43158134 (+)
G1696553 NA non-coding downstream 37450 43171463 ~ 43172287 (+)
G1696554 NA non-coding downstream 38427 43172440 ~ 43172684 (+)
G1696324 NA other upstream 353078 42779999 ~ 42780549 (+)
LOC118942073 NA other upstream 606619 42522510 ~ 42527008 (+)
LOC110499605 LOC106590859 other upstream 622380 42484544 ~ 42511247 (+)
G1695272 NA other upstream 1515122 41618027 ~ 41618505 (+)
G1693914 NA other upstream 2920674 40211522 ~ 40212953 (+)
G1696563 NA other downstream 73546 43207559 ~ 43209518 (+)
G1696904 NA other downstream 489471 43623484 ~ 43626360 (+)
G1696905 NA other downstream 492375 43626388 ~ 43661355 (+)
G1696916 NA other downstream 535551 43669564 ~ 43670353 (+)

Expression


G1696541 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1696541 Expression in each Bioproject

Bar chart with 21 bars.
G1696541 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network