G1697017



Basic Information


Item Value
gene id G1697017
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 43501425 ~ 43502041 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1941265
gtggggtggcatttctttggggggccgcacagccctccatgtgctcgccagaggtagcctgaatgccattaggtaccgagatgagatcctcagaccccttgtgagaccatatgctggtgcggttgtggctggagtgtgtcagcagttcctgcaagaggaaggcattgatgctatggactggcccgcccgttccccagacctgaatccaattgagcacatctgggacatcatgtctcgctccatccaccaacgccacgttgcaccaaagactgtccaggagttggcggatgctttagtccaggtctgggaggagatccctcaggagaccatccgccacctcatcaggagcatgcccaggcgttgtagagaggtcatacaggcacgtggaggccacacacactactgagcctcattttgacttgttttaaggacattacatcaaagttggatcagcctgtagtgtggttttccactttaattttgagtgtgactccaaatccagacctccatgggttgataaatttgatttccattgatcatttttgtatgattttgttgtcagcacattcaactatgtaaagaaaaaagtatttaataagaatatttcattcattcag
>TU1941266
gagttggcggatgctttagtccaggtctgggaggagatccctcaggagaccatccgccacctcatcaggagcatgcccaggcgttgtagagaggtcatacaggcacgtggaggccacacacactactgagcctcattttgacttgttttaaggacattacatcaaagttggatcagcctgtagtgtggttttccactttaattttgagtgtgactccaaatccagacctccatgggttgataaatttgatttccattgatcatttttgtatgattttgttgtcagcacattcaactatgtaaagaaaaaagtatttaataagaatatttcattcattcag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1941265 False 617 TUCP 0.49 1 43501425 43502041
TU1941266 True 340 lncRNA 0.42 1 43501425 43501764
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110518228 mcu coding downstream 196421 43194834 ~ 43305004 (-)
LOC110499563 LOC106589940 coding downstream 768133 42683879 ~ 42733292 (-)
LOC110499498 LOC106578834 coding downstream 856166 42597760 ~ 42645259 (-)
LOC110499497 NA coding downstream 912426 42587728 ~ 42588999 (-)
cisd1 LOC106589936 coding downstream 914386 42582333 ~ 42587039 (-)
LOC110499507 LOC106589953 coding upstream 56643 43558407 ~ 43586489 (-)
LOC110492809 unc5b coding upstream 128237 43630001 ~ 43803224 (-)
LOC118942076 NA coding upstream 303734 43805498 ~ 43807349 (-)
tbata LOC106577277 coding upstream 452919 43954683 ~ 43966333 (-)
LOC110499516 LOC106578803 coding upstream 488625 43990389 ~ 44016464 (-)
G1697014 NA non-coding downstream 5303 43495339 ~ 43496122 (-)
G1697013 NA non-coding downstream 15749 43484959 ~ 43485676 (-)
G1697012 NA non-coding downstream 16858 43484339 ~ 43484567 (-)
G1697010 NA non-coding downstream 20151 43475667 ~ 43481274 (-)
G1697001 NA non-coding downstream 44847 43456335 ~ 43456578 (-)
G1697018 NA non-coding upstream 1270 43503034 ~ 43552262 (-)
G1697021 NA non-coding upstream 14686 43516450 ~ 43517458 (-)
G1697019 NA non-coding upstream 31012 43532776 ~ 43536090 (-)
G1697039 NA non-coding upstream 102953 43604717 ~ 43606503 (-)
G1697037 NA non-coding upstream 112457 43614221 ~ 43615698 (-)
G1696714 NA other downstream 369727 43130200 ~ 43131698 (-)
G1696673 NA other downstream 452062 43047738 ~ 43049363 (-)
G1696606 NA other downstream 618633 42882169 ~ 42882792 (-)
G1696403 NA other downstream 674190 42826595 ~ 42827235 (-)
G1697090 NA other upstream 239543 43741307 ~ 43741664 (-)
G1697091 NA other upstream 243031 43744795 ~ 43745102 (-)
G1697093 NA other upstream 244735 43746499 ~ 43747178 (-)
G1697647 LOC106589972 other upstream 1035109 44490843 ~ 44551607 (-)

Expression


G1697017 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1697017 Expression in each Bioproject

Bar chart with 20 bars.
G1697017 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network