G1697080



Basic Information


Item Value
gene id G1697080
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 43726060 ~ 43726398 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1941424
agaggactgggacaacattccacaggccacaatcaacagcctgatcaactctatgtgaaggagatgtgtctcgctgcatgaggcaaatggtggaaccagatactgactggttttctgatccacaccagatactgactggttttctgatccacaccagatactgactggttttctgatccacaccagatactgactggttttctgatccacaccagatactgactggttttctgatccacaccagatactgactggttttctgatccacaccagatactgactggtgttctgatccacaccagatactgactggttttctgatccacaccagatactgac

Function


NR:

description
Transposable element Tcb1 transposase, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1941424 True 339 lncRNA 0.47 1 43726060 43726398
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499507 LOC106589953 coding downstream 139571 43558407 ~ 43586489 (-)
LOC110518228 mcu coding downstream 421056 43194834 ~ 43305004 (-)
LOC110499563 LOC106589940 coding downstream 992768 42683879 ~ 42733292 (-)
LOC110499498 LOC106578834 coding downstream 1080801 42597760 ~ 42645259 (-)
LOC110499497 NA coding downstream 1137061 42587728 ~ 42588999 (-)
LOC118942076 NA coding upstream 79100 43805498 ~ 43807349 (-)
tbata LOC106577277 coding upstream 228285 43954683 ~ 43966333 (-)
LOC110499516 LOC106578803 coding upstream 263991 43990389 ~ 44016464 (-)
LOC110499513 LOC106578802 coding upstream 331049 44057447 ~ 44081042 (-)
LOC110499524 LOC106589979 coding upstream 1320356 45046754 ~ 45059248 (-)
G1697077 NA non-coding downstream 3545 43722035 ~ 43722515 (-)
G1697076 NA non-coding downstream 5195 43720521 ~ 43720865 (-)
G1697075 LOC105030512 non-coding downstream 9434 43716208 ~ 43716626 (-)
G1697074 NA non-coding downstream 10303 43715538 ~ 43715757 (-)
G1697061 NA non-coding downstream 59419 43666135 ~ 43666641 (-)
G1697089 NA non-coding upstream 12955 43739353 ~ 43739665 (-)
G1697092 NA non-coding upstream 18816 43745214 ~ 43745431 (-)
G1697098 NA non-coding upstream 32852 43759250 ~ 43759493 (-)
G1697105 NA non-coding upstream 59531 43785929 ~ 43788524 (-)
G1697106 NA non-coding upstream 65176 43791574 ~ 43791783 (-)
LOC110492809 unc5b other downstream 85969 43630001 ~ 43803224 (-)
G1697017 NA other downstream 224019 43501425 ~ 43502041 (-)
G1696714 NA other downstream 594362 43130200 ~ 43131698 (-)
G1696673 NA other downstream 676697 43047738 ~ 43049363 (-)
G1696606 NA other downstream 843268 42882169 ~ 42882792 (-)
G1697090 NA other upstream 14909 43741307 ~ 43741664 (-)
G1697091 NA other upstream 18397 43744795 ~ 43745102 (-)
G1697093 NA other upstream 20101 43746499 ~ 43747178 (-)
G1697647 LOC106589972 other upstream 810475 44490843 ~ 44551607 (-)
G1697847 NA other upstream 953044 44679442 ~ 44681205 (-)

Expression


G1697080 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1697080 Expression in each Bioproject

Bar chart with 20 bars.
G1697080 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network