G1697089



Basic Information


Item Value
gene id G1697089
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 43739353 ~ 43739665 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1941433
tgtctacctgtgtacatgtctacatgtctacctgtgtacatgtctacatgtctacatgtctacctgcgtacatgtctacatgtctacctgcgtacatgtctacctgtgtacatgtcttcatgtctacctgtgtacatgtctacatgtctacctgtgtacatgtctacatatctacctgtgtacatgtctacctgtctaaatgtctacctgtgtacatgtctacatgtctaaatgtctacctgtgtacatgtctacatgtctacctgcgtacatgtctacctgcgtacatgtctacctgcgtacatgtctacct

Function


NR:

description
hypothetical protein EH28_03297, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1941433 True 313 lncRNA 0.43 1 43739353 43739665
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499507 LOC106589953 coding downstream 152864 43558407 ~ 43586489 (-)
LOC110518228 mcu coding downstream 434349 43194834 ~ 43305004 (-)
LOC110499563 LOC106589940 coding downstream 1006061 42683879 ~ 42733292 (-)
LOC110499498 LOC106578834 coding downstream 1094094 42597760 ~ 42645259 (-)
LOC110499497 NA coding downstream 1150354 42587728 ~ 42588999 (-)
LOC118942076 NA coding upstream 65833 43805498 ~ 43807349 (-)
tbata LOC106577277 coding upstream 215018 43954683 ~ 43966333 (-)
LOC110499516 LOC106578803 coding upstream 250724 43990389 ~ 44016464 (-)
LOC110499513 LOC106578802 coding upstream 317782 44057447 ~ 44081042 (-)
LOC110499524 LOC106589979 coding upstream 1307089 45046754 ~ 45059248 (-)
G1697080 NA non-coding downstream 12955 43726060 ~ 43726398 (-)
G1697077 NA non-coding downstream 16838 43722035 ~ 43722515 (-)
G1697076 NA non-coding downstream 18488 43720521 ~ 43720865 (-)
G1697075 LOC105030512 non-coding downstream 22727 43716208 ~ 43716626 (-)
G1697074 NA non-coding downstream 23596 43715538 ~ 43715757 (-)
G1697092 NA non-coding upstream 5549 43745214 ~ 43745431 (-)
G1697098 NA non-coding upstream 19585 43759250 ~ 43759493 (-)
G1697105 NA non-coding upstream 46264 43785929 ~ 43788524 (-)
G1697106 NA non-coding upstream 51909 43791574 ~ 43791783 (-)
G1697122 NA non-coding upstream 80193 43819858 ~ 43820091 (-)
LOC110492809 unc5b other downstream 99262 43630001 ~ 43803224 (-)
G1697017 NA other downstream 237312 43501425 ~ 43502041 (-)
G1696714 NA other downstream 607655 43130200 ~ 43131698 (-)
G1696673 NA other downstream 689990 43047738 ~ 43049363 (-)
G1696606 NA other downstream 856561 42882169 ~ 42882792 (-)
G1697090 NA other upstream 1642 43741307 ~ 43741664 (-)
G1697091 NA other upstream 5130 43744795 ~ 43745102 (-)
G1697093 NA other upstream 6834 43746499 ~ 43747178 (-)
G1697647 LOC106589972 other upstream 797208 44490843 ~ 44551607 (-)
G1697847 NA other upstream 939777 44679442 ~ 44681205 (-)

Expression


G1697089 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1697089 Expression in each Bioproject

Bar chart with 8 bars.
G1697089 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network