G1697155



Basic Information


Item Value
gene id G1697155
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 43873230 ~ 43893834 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1941525
atattaccctggtctaccatctactgtcattatattaccctggtctctactgtcattatattatgctggtctaccctctactgtcattatattaccctggtctctactgtcattattttaccctggtctaccatctactgtcattatattaccctggtctaccatctactctcattatattaccctggtctcccctctactgtcattatattaccctggtctaccatctactgtcattatattaccctggtctaga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1941525 True 256 lncRNA 0.39 2 43873230 43893834
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499505 LOC106589952 coding upstream 257532 43552789 ~ 43615700 (+)
LOC118942021 micu1 coding upstream 379049 43448714 ~ 43494181 (+)
LOC110510394 NA coding upstream 470466 43371693 ~ 43402764 (+)
LOC110499564 NA coding upstream 724861 43137388 ~ 43148369 (+)
LOC110499502 pde10a coding upstream 751335 42950949 ~ 43125594 (+)
LOC110499517 LOC106589992 coding downstream 83446 43977280 ~ 43987101 (+)
LOC110499607 NA coding downstream 130185 44024019 ~ 44028357 (+)
LOC110499515 LOC106589989 coding downstream 140654 44034488 ~ 44055611 (+)
capn2 LOC106589959 coding downstream 197566 44091400 ~ 44134903 (+)
LOC110499567 LOC106589958 coding downstream 241175 44135009 ~ 44181809 (+)
G1697149 NA non-coding upstream 9721 43862978 ~ 43863509 (+)
G1697139 NA non-coding upstream 17381 43855238 ~ 43855849 (+)
G1696964 NA non-coding upstream 31728 43841205 ~ 43841502 (+)
G1696961 NA non-coding upstream 40746 43829667 ~ 43832484 (+)
G1696959 NA non-coding upstream 48110 43824897 ~ 43825120 (+)
G1697166 NA non-coding downstream 15166 43909000 ~ 43954471 (+)
G1697168 NA non-coding downstream 36063 43929897 ~ 43942030 (+)
G1697232 NA non-coding downstream 163624 44057458 ~ 44068769 (+)
G1697234 NA non-coding downstream 166229 44060063 ~ 44061339 (+)
G1697269 NA non-coding downstream 273085 44166919 ~ 44167354 (+)
G1696916 NA other upstream 202877 43669564 ~ 43670353 (+)
G1696905 NA other upstream 211875 43626388 ~ 43661355 (+)
G1696904 NA other upstream 246870 43623484 ~ 43626360 (+)
G1696563 NA other upstream 663712 43207559 ~ 43209518 (+)
G1697222 NA other downstream 337488 44231322 ~ 44231767 (+)
G1697374 NA other downstream 604826 44498660 ~ 44499846 (+)
LOC110499568 LOC106589976 other downstream 993233 44885773 ~ 44922697 (+)
G1698119 yo84 other downstream 1217732 45111566 ~ 45112361 (+)
G1698413 i2b2b other downstream 1802362 45696196 ~ 45697330 (+)

Expression


G1697155 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1697155 Expression in each Bioproject

Bar chart with 3 bars.
G1697155 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network