G1697494



Basic Information


Item Value
gene id G1697494
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 44155109 ~ 44155770 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1942081
tgacctgcctatactgatagatagacctagtgcacggttctgtctgtctggtggctgacctgcctatactgatagatagacctagtgcacggttctgtctgtctggtggctgacctgcctatactgatagatagacctagtgcacggttctgtctgtctggttgctgacctgcctatactgatagatagacctagtgcacggttct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1942081 True 206 lncRNA 0.50 2 44155109 44155770
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499513 LOC106578802 coding downstream 74067 44057447 ~ 44081042 (-)
LOC110499516 LOC106578803 coding downstream 138645 43990389 ~ 44016464 (-)
tbata LOC106577277 coding downstream 188776 43954683 ~ 43966333 (-)
LOC118942076 NA coding downstream 347760 43805498 ~ 43807349 (-)
LOC110492809 unc5b coding downstream 351885 43630001 ~ 43803224 (-)
LOC110499524 LOC106589979 coding upstream 890984 45046754 ~ 45059248 (-)
LOC110499570 NA coding upstream 936131 45091901 ~ 45097715 (-)
LOC110499526 LOC106578779 coding upstream 1317378 45473148 ~ 45496223 (-)
trnah-gug-109 NA coding upstream 1341269 45497039 ~ 45497110 (-)
LOC110499572 LOC106578653 coding upstream 1344372 45500142 ~ 45560428 (-)
G1697420 NA non-coding downstream 20205 44133009 ~ 44134904 (-)
G1697466 NA non-coding downstream 71855 44082971 ~ 44083254 (-)
G1697439 NA non-coding downstream 132872 44021530 ~ 44022237 (-)
G1697419 LOC106589992 non-coding downstream 168026 43977375 ~ 43987083 (-)
G1697405 NA non-coding downstream 210363 43933841 ~ 43944746 (-)
G1697489 NA non-coding upstream 23933 44179703 ~ 44181788 (-)
G1697534 NA non-coding upstream 63107 44218877 ~ 44219544 (-)
G1697535 NA non-coding upstream 64135 44219905 ~ 44320908 (-)
G1697547 NA non-coding upstream 81343 44237113 ~ 44237485 (-)
G1697555 NA non-coding upstream 93968 44249738 ~ 44251244 (-)
G1697093 NA other downstream 407931 43746499 ~ 43747178 (-)
G1697091 NA other downstream 410007 43744795 ~ 43745102 (-)
G1697090 NA other downstream 413445 43741307 ~ 43741664 (-)
G1697017 NA other downstream 653068 43501425 ~ 43502041 (-)
G1697647 LOC106589972 other upstream 381103 44490843 ~ 44551607 (-)
G1697847 NA other upstream 523672 44679442 ~ 44681205 (-)
G1697879 NA other upstream 603856 44759626 ~ 44760029 (-)
G1697887 NA other upstream 625644 44781414 ~ 44820534 (-)
G1697885 NA other upstream 625742 44781512 ~ 44836723 (-)

Expression


G1697494 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1697494 Expression in each Bioproject

Bar chart with 19 bars.
G1697494 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network