G1697867



Basic Information


Item Value
gene id G1697867
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 44730116 ~ 44730459 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1942569
ATACTGAACTAACCATAACTATACTGAACTAACCATCACTATAATGATCTAACCATAACTATAATGATCTAACCATAACTATACTGAACTAACCATCACTATAATGAACTAACTATAACTAACCAAAACTATCCTGAACTAACCATAACTATACTGAACTAACCATAACTATACTGAACTAACCATCACTATAATGAACTAACCAAAACTATAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1942569 True 214 lncRNA 0.29 2 44730116 44730459

Neighbor


gene id symbol gene type direction distance location
LOC110499513 LOC106578802 coding downstream 649074 44057447 ~ 44081042 (-)
LOC110499516 LOC106578803 coding downstream 713652 43990389 ~ 44016464 (-)
tbata LOC106577277 coding downstream 763783 43954683 ~ 43966333 (-)
LOC118942076 NA coding downstream 922767 43805498 ~ 43807349 (-)
LOC110492809 unc5b coding downstream 926892 43630001 ~ 43803224 (-)
LOC110499524 LOC106589979 coding upstream 316295 45046754 ~ 45059248 (-)
LOC110499570 NA coding upstream 361442 45091901 ~ 45097715 (-)
LOC110499526 LOC106578779 coding upstream 742689 45473148 ~ 45496223 (-)
trnah-gug-109 NA coding upstream 766580 45497039 ~ 45497110 (-)
LOC110499572 LOC106578653 coding upstream 769683 45500142 ~ 45560428 (-)
G1697866 NA non-coding downstream 3046 44726430 ~ 44727070 (-)
G1697749 NA non-coding downstream 72994 44656730 ~ 44657122 (-)
G1697738 NA non-coding downstream 87425 44642486 ~ 44642691 (-)
G1697736 NA non-coding downstream 90858 44638880 ~ 44639258 (-)
G1697717 NA non-coding downstream 99283 44594910 ~ 44630833 (-)
G1697889 NA non-coding upstream 57445 44787904 ~ 44792235 (-)
G1697892 NA non-coding upstream 93714 44824173 ~ 44826583 (-)
G1697886 NA non-coding upstream 95014 44825473 ~ 44828153 (-)
G1697885 NA non-coding upstream 97955 44781512 ~ 44836723 (-)
G1697895 NA non-coding upstream 107134 44837593 ~ 44884302 (-)
G1697847 NA other downstream 48911 44679442 ~ 44681205 (-)
G1697647 LOC106589972 other downstream 191651 44490843 ~ 44551607 (-)
G1697093 NA other downstream 982938 43746499 ~ 43747178 (-)
G1697091 NA other downstream 985014 43744795 ~ 43745102 (-)
G1697090 NA other downstream 988452 43741307 ~ 43741664 (-)
G1697879 NA other upstream 29167 44759626 ~ 44760029 (-)
G1697887 NA other upstream 50955 44781414 ~ 44820534 (-)
G1697888 NA other upstream 53147 44783606 ~ 44811252 (-)
G1697911 NA other upstream 164659 44895118 ~ 44898551 (-)

Expression


G1697867 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1697867 Expression in each Bioproject

Bar chart with 4 bars.
G1697867 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network