G1697889



Basic Information


Item Value
gene id G1697889
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 44787904 ~ 44792235 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1942603
tttattaccctggtctaccatctactgtcattatattaccctggtctaccatctactgtcattatattaccctggtattaccctggtctaccatctactgtcattatattaccctggtctaccatctactgtcattatattaccccggtctaccatctactgtcattatattaccctggtctaccatctactgtcattatattaccctggtctaccctctactgtcattatattaccctggtctaccatctactgtcattctatttccctggtctaccatctactgtcattatattaccctggtctaccctctactgtcattatattaccctggtctaccatctactgtcattatatttccctggtctaccatctactgtcattatattaccctgttattaccctggtctaccatctactctcattatattaccctggtctaccatctactgtcattatattaccctggtctaccatagtaaaaccaagtgctagtaaaaccaaatgcatgcttttcaaccgttcgctgcctgcacccgcacgcctgaccagcatcaccaccctggatggttccgaccttgaatatgtgg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1942603 True 590 lncRNA 0.42 2 44787904 44792235

Neighbor


gene id symbol gene type direction distance location
LOC110499513 LOC106578802 coding downstream 706862 44057447 ~ 44081042 (-)
LOC110499516 LOC106578803 coding downstream 771440 43990389 ~ 44016464 (-)
tbata LOC106577277 coding downstream 821571 43954683 ~ 43966333 (-)
LOC118942076 NA coding downstream 980555 43805498 ~ 43807349 (-)
LOC110492809 unc5b coding downstream 984680 43630001 ~ 43803224 (-)
LOC110499524 LOC106589979 coding upstream 254519 45046754 ~ 45059248 (-)
LOC110499570 NA coding upstream 299666 45091901 ~ 45097715 (-)
LOC110499526 LOC106578779 coding upstream 680913 45473148 ~ 45496223 (-)
trnah-gug-109 NA coding upstream 704804 45497039 ~ 45497110 (-)
LOC110499572 LOC106578653 coding upstream 707907 45500142 ~ 45560428 (-)
G1697867 NA non-coding downstream 57445 44730116 ~ 44730459 (-)
G1697866 NA non-coding downstream 60834 44726430 ~ 44727070 (-)
G1697749 NA non-coding downstream 130782 44656730 ~ 44657122 (-)
G1697738 NA non-coding downstream 145213 44642486 ~ 44642691 (-)
G1697736 NA non-coding downstream 148646 44638880 ~ 44639258 (-)
G1697892 NA non-coding upstream 31938 44824173 ~ 44826583 (-)
G1697886 NA non-coding upstream 33238 44825473 ~ 44828153 (-)
G1697885 NA non-coding upstream 36179 44781512 ~ 44836723 (-)
G1697895 NA non-coding upstream 45358 44837593 ~ 44884302 (-)
G1697898 NA non-coding upstream 50780 44843015 ~ 44859830 (-)
G1697879 NA other downstream 27875 44759626 ~ 44760029 (-)
G1697847 NA other downstream 106699 44679442 ~ 44681205 (-)
G1697647 LOC106589972 other downstream 249439 44490843 ~ 44551607 (-)
G1697093 NA other downstream 1040726 43746499 ~ 43747178 (-)
G1697091 NA other downstream 1042802 43744795 ~ 43745102 (-)
G1697911 NA other upstream 102883 44895118 ~ 44898551 (-)
G1697921 NA other upstream 128144 44920379 ~ 44922126 (-)
G1698163 NA other upstream 373471 45165706 ~ 45166383 (-)
G1698656 NA other upstream 870087 45662322 ~ 45663716 (-)
G1699034 NA other upstream 1269970 46062205 ~ 46062556 (-)

Expression


G1697889 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1697889 Expression in each Bioproject

Bar chart with 4 bars.
G1697889 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network