G1697910



Basic Information


Item Value
gene id G1697910
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 44894122 ~ 44894554 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1942647
ggaggctatatacagggggcaccagtacagagtcagtgtggaggctatatacagggggcaccagtacagagtcggtgtggaggctatatacagggggcaccggtaccgagtcaatgtggagactatatacagggggcaccggtactgagtcagtgtggagactatgtacagggggcaccggtactgagtcaatgtggagactatatacagggggcaccggtactgagtcagtgtggagactatgtacagggggcaccggtactgagtcaatgaggagactatatacagggggcaccggtactgagtcagtgtggagactatatacagggggcaccagtactgagtcagtgtggaggctatatacagggggcaccggtactgagtcagtgtggag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1942647 True 394 lncRNA 0.55 2 44894122 44894554
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499513 LOC106578802 coding downstream 813080 44057447 ~ 44081042 (-)
LOC110499516 LOC106578803 coding downstream 877658 43990389 ~ 44016464 (-)
tbata LOC106577277 coding downstream 927789 43954683 ~ 43966333 (-)
LOC118942076 NA coding downstream 1086773 43805498 ~ 43807349 (-)
LOC110492809 unc5b coding downstream 1090898 43630001 ~ 43803224 (-)
LOC110499524 LOC106589979 coding upstream 152200 45046754 ~ 45059248 (-)
LOC110499570 NA coding upstream 197347 45091901 ~ 45097715 (-)
LOC110499526 LOC106578779 coding upstream 578594 45473148 ~ 45496223 (-)
trnah-gug-109 NA coding upstream 602485 45497039 ~ 45497110 (-)
LOC110499572 LOC106578653 coding upstream 605588 45500142 ~ 45560428 (-)
G1697909 NA non-coding downstream 324 44892415 ~ 44893798 (-)
G1697895 NA non-coding downstream 9820 44837593 ~ 44884302 (-)
G1697896 NA non-coding downstream 27083 44844401 ~ 44867039 (-)
G1697898 NA non-coding downstream 34292 44843015 ~ 44859830 (-)
G1697885 NA non-coding downstream 58717 44781512 ~ 44836723 (-)
G1697924 NA non-coding upstream 30569 44925123 ~ 44926821 (-)
G1697930 NA non-coding upstream 37855 44932409 ~ 44934778 (-)
G1697941 NA non-coding upstream 47853 44942407 ~ 44942751 (-)
G1697944 NA non-coding upstream 50748 44945302 ~ 44945558 (-)
G1697956 NA non-coding upstream 62965 44957519 ~ 44958095 (-)
G1697887 NA other downstream 73588 44781414 ~ 44820534 (-)
G1697888 NA other downstream 82870 44783606 ~ 44811252 (-)
G1697879 NA other downstream 134093 44759626 ~ 44760029 (-)
G1697847 NA other downstream 212917 44679442 ~ 44681205 (-)
G1697911 NA other upstream 564 44895118 ~ 44898551 (-)
G1697921 NA other upstream 25825 44920379 ~ 44922126 (-)
G1698163 NA other upstream 271152 45165706 ~ 45166383 (-)
G1698656 NA other upstream 767768 45662322 ~ 45663716 (-)
G1699034 NA other upstream 1167651 46062205 ~ 46062556 (-)

Expression


G1697910 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1697910 Expression in each Bioproject

Bar chart with 11 bars.
G1697910 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network