G1697911



Basic Information


Item Value
gene id G1697911
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 44895118 ~ 44898551 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1942651
gtacagagtcaatgtggaggctatatacagggtattacagtacagagtcagtgtggaggctatatacagggtattatggtacagagtcaatgtggaggctatatacaggggggtaccagtacagagtcaatgtggaggctatatacaggggggtaccagtacagagtcaatgtggaggctatatacagggtattacagtacagagtcagtgtggaggctatatacagggtattacagtacagagtcagtgtggaggctatatacagggtattacagtacagagtcaatgtggaggctatatacagggtattacagtacagagtcagtgtggaggctatatacagggggcacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1942651 True 352 TUCP 0.45 2 44895118 44898551

Neighbor


gene id symbol gene type direction distance location
LOC110499513 LOC106578802 coding downstream 814076 44057447 ~ 44081042 (-)
LOC110499516 LOC106578803 coding downstream 878654 43990389 ~ 44016464 (-)
tbata LOC106577277 coding downstream 928785 43954683 ~ 43966333 (-)
LOC118942076 NA coding downstream 1087769 43805498 ~ 43807349 (-)
LOC110492809 unc5b coding downstream 1091894 43630001 ~ 43803224 (-)
LOC110499524 LOC106589979 coding upstream 148203 45046754 ~ 45059248 (-)
LOC110499570 NA coding upstream 193350 45091901 ~ 45097715 (-)
LOC110499526 LOC106578779 coding upstream 574597 45473148 ~ 45496223 (-)
trnah-gug-109 NA coding upstream 598488 45497039 ~ 45497110 (-)
LOC110499572 LOC106578653 coding upstream 601591 45500142 ~ 45560428 (-)
G1697910 NA non-coding downstream 564 44894122 ~ 44894554 (-)
G1697909 NA non-coding downstream 1320 44892415 ~ 44893798 (-)
G1697895 NA non-coding downstream 10816 44837593 ~ 44884302 (-)
G1697896 NA non-coding downstream 28079 44844401 ~ 44867039 (-)
G1697898 NA non-coding downstream 35288 44843015 ~ 44859830 (-)
G1697924 NA non-coding upstream 26572 44925123 ~ 44926821 (-)
G1697930 NA non-coding upstream 33858 44932409 ~ 44934778 (-)
G1697941 NA non-coding upstream 43856 44942407 ~ 44942751 (-)
G1697944 NA non-coding upstream 46751 44945302 ~ 44945558 (-)
G1697956 NA non-coding upstream 58968 44957519 ~ 44958095 (-)
G1697885 NA other downstream 58395 44781512 ~ 44836723 (-)
G1697887 NA other downstream 74584 44781414 ~ 44820534 (-)
G1697888 NA other downstream 83866 44783606 ~ 44811252 (-)
G1697879 NA other downstream 135089 44759626 ~ 44760029 (-)
G1697847 NA other downstream 213913 44679442 ~ 44681205 (-)
G1697921 NA other upstream 21828 44920379 ~ 44922126 (-)
G1698163 NA other upstream 267155 45165706 ~ 45166383 (-)
G1698656 NA other upstream 763771 45662322 ~ 45663716 (-)
G1699034 NA other upstream 1163654 46062205 ~ 46062556 (-)
G1699121 NA other upstream 1393631 46292182 ~ 46293900 (-)

Expression


G1697911 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1697911 Expression in each Bioproject

Bar chart with 20 bars.
G1697911 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network