G1698292



Basic Information


Item Value
gene id G1698292
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 45413019 ~ 45413521 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1943122
CAGGAGTAACACAACCCATAGCCAGGAGGTACACAACCCATAGCCAGGCCTGGAGGCAGGAGGTACACAACCCATAGCCAGGTGGCAGGAGGTACACAACCCATAGCCTGGTGGCAGGAGGTACACAACCCATAGCCAGGTGGCAGGAGGTACACAACCCATAGCCAGGTGGCAGGAGGTACACAACCCATAGCCAGGTGGCACGAGTAACACAACCCATAGCCAGGCTTGGTGGCAGGAGTAACACAACCCATAGCCAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1943122 True 261 lncRNA 0.57 2 45413019 45413521

Neighbor


gene id symbol gene type direction distance location
LOC110499568 LOC106589976 coding upstream 490322 44885773 ~ 44922697 (+)
LOC110499508 LOC106589972 coding upstream 875301 44402023 ~ 44537718 (+)
LOC110499511 LOC106578785 coding upstream 1051045 44337645 ~ 44361974 (+)
LOC110499510 LOC106589963 coding upstream 1085770 44298168 ~ 44327249 (+)
LOC110499566 LOC105028001 coding upstream 1149602 44181988 ~ 44263417 (+)
LOC118942022 NA coding downstream 265404 45678925 ~ 45679902 (+)
LOC118942078 NA coding downstream 609373 46022894 ~ 46025800 (+)
tsnax tsnax coding downstream 744113 46157634 ~ 46174248 (+)
disc1 LOC106595121 coding downstream 765080 46178601 ~ 46308949 (+)
LOC110499530 LOC106590013 coding downstream 998991 46412512 ~ 46501346 (+)
G1698293 NA non-coding upstream 4156 45408580 ~ 45408863 (+)
G1698291 NA non-coding upstream 11954 45400636 ~ 45401065 (+)
G1698273 NA non-coding upstream 67723 45340809 ~ 45345296 (+)
G1698261 NA non-coding upstream 91546 45321018 ~ 45321473 (+)
G1698259 NA non-coding upstream 93717 45319028 ~ 45319302 (+)
G1698295 NA non-coding downstream 3062 45416583 ~ 45417201 (+)
G1698313 NA non-coding downstream 42709 45456230 ~ 45457602 (+)
G1698265 NA non-coding downstream 54703 45468224 ~ 45522863 (+)
G1698338 NA non-coding downstream 86657 45500178 ~ 45501566 (+)
G1698347 NA non-coding downstream 101370 45514891 ~ 45586897 (+)
G1698119 yo84 other upstream 300658 45111566 ~ 45112361 (+)
G1697374 NA other upstream 913173 44498660 ~ 44499846 (+)
G1697222 NA other upstream 1181252 44231322 ~ 44231767 (+)
G1697152 NA other upstream 1508161 43867229 ~ 43908497 (+)
G1698413 i2b2b other downstream 282675 45696196 ~ 45697330 (+)
G1698414 NA other downstream 286569 45700090 ~ 45701101 (+)
G1698884 NA other downstream 775424 46188945 ~ 46190421 (+)
LOC110499521 msmb other downstream 1133251 46546637 ~ 46552961 (+)
LOC118942483 NA other downstream 1168349 46580927 ~ 46588053 (+)

Expression


G1698292 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1698292 Expression in each Bioproject

Bar chart with 12 bars.
G1698292 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network