trnar-ucu-10



Basic Information


Item Value
gene id trnar-ucu-10
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 59516421 ~ 59516493 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnar-ucu-10
gccccagtggcctaatggataaggcactggccttctaagccagggattgtgggtttgagtcccatctggggtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnar-ucu-10 True 73 mRNA 0.58 1 59516421 59516493
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500769 LOC106608502 coding upstream 1918 59463593 ~ 59514503 (+)
LOC118942960 NA coding upstream 17877 59493489 ~ 59498544 (+)
LOC110500773 LOC106608508 coding upstream 168276 59343608 ~ 59348145 (+)
elavl2 elavl2 coding upstream 611970 58851083 ~ 58904451 (+)
LOC110500780 caap1 coding upstream 992791 58512708 ~ 58523630 (+)
trnar-ucu-11 NA coding downstream 433 59516926 ~ 59516998 (+)
trnar-ucu-12 NA coding downstream 1584 59518077 ~ 59518149 (+)
trnar-ucu-13 NA coding downstream 2392 59518885 ~ 59518957 (+)
trnar-ucu-14 NA coding downstream 3015 59519508 ~ 59519580 (+)
trnar-ucu-15 NA coding downstream 3824 59520317 ~ 59520389 (+)
G1758254 NA non-coding upstream 58114 59455432 ~ 59458307 (+)
G1758238 NA non-coding upstream 89233 59425968 ~ 59427188 (+)
G1758236 NA non-coding upstream 92209 59422251 ~ 59424212 (+)
G1758215 NA non-coding upstream 141846 59371537 ~ 59374575 (+)
G1758205 NA non-coding upstream 158877 59357166 ~ 59357544 (+)
G1758366 NA non-coding downstream 132765 59649258 ~ 59651646 (+)
LOC118942794 NA non-coding downstream 156953 59673446 ~ 59676937 (+)
G1758387 NA non-coding downstream 161199 59677692 ~ 59682011 (+)
G1758388 NA non-coding downstream 163752 59680245 ~ 59683805 (+)
G1758393 NA non-coding downstream 172118 59688611 ~ 59695262 (+)
G1757578 NA other upstream 829898 58683137 ~ 58686523 (+)
rwdd rwdd4 other upstream 1106342 58405236 ~ 58411726 (+)
G1756789 NA other upstream 1588177 57926480 ~ 57928244 (+)
G1755570 NA other upstream 2721847 56793731 ~ 56794574 (+)
G1755158 NA other upstream 3128799 56386407 ~ 56387622 (+)
G1758801 NA other downstream 805722 60322215 ~ 60326620 (+)
G1758818 NA other downstream 835153 60351646 ~ 60353092 (+)
G1758786 NA other downstream 842337 60358349 ~ 60359351 (+)
G1759168 LOC101154678 other downstream 1205665 60722158 ~ 60722472 (+)
G1759267 NA other downstream 1293709 60810202 ~ 60810620 (+)

Expression


trnar-ucu-10 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network