G1700800



Basic Information


Item Value
gene id G1700800
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 1593220 ~ 1593454 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1946391
AGACCATTCTGAAACCAAGTGGTAAGACCATTCTGAAACCAAGTGGTAAGAAAGACCATTCTGAAACCAAGTGGTAAGGAAGACCATTCTGAAACCAAGTGGTAAAAAAGACCATTCTGAAACCAAGTGGTAAGAAAGACCATTCTGAAACCAAGTGGTAAGAAAGGCCATTCTGAAACCAAGTGGTAAGAAAGACCATTCTGAAACCAAGTGGTAAGAAAGACCATTCTGAAAC

Function


NR:

description
oocyte zinc finger protein XlCOF6-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1946391 True 235 lncRNA 0.40 1 1593220 1593454

Neighbor


gene id symbol gene type direction distance location
LOC110511332 LOC106576651 coding downstream 77036 1500431 ~ 1516184 (-)
LOC110499704 cpsf6 coding downstream 116703 1454566 ~ 1513068 (-)
LOC110499705 LOC106609801 coding downstream 139334 1448804 ~ 1453886 (-)
LOC118942825 frs2 coding downstream 146803 1363229 ~ 1446417 (-)
LOC110527029 LOC106592131 coding downstream 236189 1348599 ~ 1357031 (-)
ptprbl LOC106609809 coding upstream 270520 1863974 ~ 1985304 (-)
LOC118942826 NA coding upstream 392456 1985910 ~ 1990032 (-)
LOC110499711 ptprr coding upstream 398023 1991477 ~ 2085804 (-)
LOC110512520 LOC106609724 coding upstream 519588 2113042 ~ 2128710 (-)
LOC110499714 LOC106609803 coding upstream 535579 2129033 ~ 2138088 (-)
G1700778 NA non-coding downstream 54241 1537791 ~ 1538979 (-)
G1700766 NA non-coding downstream 88429 1504505 ~ 1504791 (-)
G1700710 NA non-coding downstream 92812 1442197 ~ 1500408 (-)
G1700760 NA non-coding downstream 100864 1491453 ~ 1492356 (-)
G1700802 NA non-coding upstream 3968 1597422 ~ 1647912 (-)
G1700818 NA non-coding upstream 42977 1636431 ~ 1637059 (-)
G1700820 NA non-coding upstream 44637 1638091 ~ 1733616 (-)
G1700827 NA non-coding upstream 72203 1665657 ~ 1668599 (-)
G1700829 NA non-coding upstream 88133 1681587 ~ 1682378 (-)
LOC110511372 LOC106592130 other downstream 269857 1319221 ~ 1348497 (-)
G1700312 NA other downstream 1238711 352487 ~ 354509 (-)
G1701041 NA other upstream 594979 2188433 ~ 2189666 (-)
G1701824 NA other upstream 979220 2572603 ~ 2577051 (-)
G1701930 NA other upstream 1190488 2783942 ~ 2829582 (-)
G1702117 NA other upstream 1635548 3229002 ~ 3230041 (-)

Expression


G1700800 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1700800 Expression in each Bioproject

Bar chart with 5 bars.
G1700800 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network