G1699897



Basic Information


Item Value
gene id G1699897
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 1797339 ~ 1797781 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1945237
CAGAAAAATACTCCCGGTTGGACTGAAACAGTAGAGATAACAGAGCCAGAAAAATACTCCCGGTTGGACTGAAACAGTAGAGATAACAGAGCCAGAAAAATACTCCCAGTTGGACTGAAACAGTAGAGATAACAGAGCCAGAAAAATACTCCCAGTTGGACTGAAACAGTAGAGATAACAGAGCCAGAAAAATACTCCCGGATGCAATGGAAACAGTAGAGATAACAGAGCCAGAAAAATAAGCCCAGTTGCACTGGAAACAGTAGAGATAACAGAGCCAGAATGACTCCCAGTTGCACTGGAAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1945237 True 306 lncRNA 0.43 2 1797339 1797781
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499743 cnot2 coding upstream 27685 1688942 ~ 1769720 (+)
LOC118942986 NA coding upstream 124046 1671059 ~ 1673293 (+)
LOC110500915 LOC106576535 coding upstream 128119 1607414 ~ 1669220 (+)
LOC110517600 rab3ip coding upstream 197257 1517362 ~ 1600082 (+)
LOC110499710 LOC106596118 coding upstream 297283 1489693 ~ 1500056 (+)
LOC110499712 LOC106576627 coding downstream 295985 2093766 ~ 2102425 (+)
LOC118942829 LOC105023115 coding downstream 460935 2258716 ~ 2443078 (+)
LOC110490688 NA coding downstream 647825 2445606 ~ 2447635 (+)
LOC110499733 LOC106609838 coding downstream 711246 2509027 ~ 2531457 (+)
trnak-cuu-138 NA coding downstream 723471 2521252 ~ 2521324 (+)
G1699885 NA non-coding upstream 20767 1775798 ~ 1776572 (+)
G1699882 NA non-coding upstream 24773 1772054 ~ 1772566 (+)
G1699880 NA non-coding upstream 32883 1763963 ~ 1764456 (+)
G1699877 NA non-coding upstream 35261 1760437 ~ 1762078 (+)
G1699901 NA non-coding downstream 4017 1801798 ~ 1802894 (+)
G1699907 NA non-coding downstream 10094 1807875 ~ 1808193 (+)
G1699912 NA non-coding downstream 18254 1816035 ~ 1816417 (+)
G1699922 NA non-coding downstream 47721 1845502 ~ 1846128 (+)
LOC110536528 kcnmb4 non-coding downstream 55986 1781883 ~ 1855471 (+)
G1699804 NA other upstream 258459 1537956 ~ 1538880 (+)
G1699724 LOC106592130 other upstream 454201 1342499 ~ 1343138 (+)
LOC110518351 LOC103459268 other upstream 492606 1156714 ~ 1305903 (+)
G1699934 NA other downstream 69913 1867694 ~ 1869554 (+)
LOC110519348 tbc1d15 other downstream 841559 2588642 ~ 2667278 (+)
G1701265 NA other downstream 1046923 2844704 ~ 2849603 (+)
G1701596 NA other downstream 1976258 3774039 ~ 3776261 (+)
G1701654 NA other downstream 2135006 3932787 ~ 3936037 (+)

Expression


G1699897 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1699897 Expression in each Bioproject

Bar chart with 11 bars.
G1699897 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network