G1701065



Basic Information


Item Value
gene id G1701065
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 2267500 ~ 2267900 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1946751
TACTGTGTTTAGTGTGATTCTATAAACATCTAGACAGGACAGGTACTGTGTTTAGTGTGATTCTATAAACATCTAGACAGGACAGGTACTGTGTTTGGTGTGATTCTATAAACATCTAGACAGGACAGGTACTGTGTTGAGTGTGATTCTATAAACATCTAGACAGGACAGGTACTGTGTTTGGTGTGATTCTATAAACATCTAGACAGGACAGGTACTGTGTTGAGTGTGATTCTATAAACATCTAGACAGGACAGGTACTGTGTTGAGTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1946751 True 272 lncRNA 0.39 2 2267500 2267900
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499718 LOC106594636 coding downstream 44300 2190139 ~ 2223200 (-)
LOC118942828 LOC106594636 coding downstream 108544 2150983 ~ 2158956 (-)
LOC118942827 NA coding downstream 117789 2143995 ~ 2149711 (-)
LOC110499714 LOC106609803 coding downstream 129412 2129033 ~ 2138088 (-)
LOC110512520 LOC106609724 coding downstream 138790 2113042 ~ 2128710 (-)
LOC118942830 NA coding upstream 761449 3029349 ~ 3030468 (-)
LOC110499739 grip1 coding upstream 1320630 3585864 ~ 4306764 (-)
trnav-uac-23 NA coding upstream 1945992 4213892 ~ 4213965 (-)
LOC110499732 dyrk2 coding upstream 2343982 4611882 ~ 4636619 (-)
LOC110516460 LOC106593189 coding upstream 2424983 4692883 ~ 4704523 (-)
G1701046 NA non-coding downstream 51295 2215698 ~ 2216205 (-)
G1701045 NA non-coding downstream 55457 2211004 ~ 2212043 (-)
G1701038 NA non-coding downstream 81242 2174323 ~ 2186258 (-)
G1701040 NA non-coding downstream 88585 2176857 ~ 2178915 (-)
G1701020 NA non-coding downstream 132258 2134847 ~ 2135242 (-)
G1701070 NA non-coding upstream 9945 2277845 ~ 2280070 (-)
G1701073 NA non-coding upstream 16414 2284314 ~ 2290998 (-)
G1701096 NA non-coding upstream 69921 2337821 ~ 2338098 (-)
G1701105 NA non-coding upstream 115403 2383303 ~ 2387446 (-)
G1701108 NA non-coding upstream 128488 2396388 ~ 2397357 (-)
G1701041 NA other downstream 77834 2188433 ~ 2189666 (-)
LOC118942825 frs2 other downstream 821624 1363229 ~ 1446417 (-)
LOC110511372 LOC106592130 other downstream 944137 1319221 ~ 1348497 (-)
G1700312 NA other downstream 1912991 352487 ~ 354509 (-)
G1701824 NA other upstream 304774 2572603 ~ 2577051 (-)
G1701930 NA other upstream 516042 2783942 ~ 2829582 (-)
G1702117 NA other upstream 961102 3229002 ~ 3230041 (-)
G1702141 NA other upstream 1013202 3281102 ~ 3518377 (-)

Expression


G1701065 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1701065 Expression in each Bioproject

Bar chart with 8 bars.
G1701065 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network