G1702225



Basic Information


Item Value
gene id G1702225
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 3537212 ~ 3537451 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1948302
CTGTAGATCTGGTATGTAACTCTGGTCTGTAGCTCTGCTCTGTAACTCTGGTCTGTAACTCTGGTCTGTAACTCTGGTCTGTAACTCTGGTCTGTATCTCTGGTCTGTAACTCTGGTCTGTAACTCTGGTCTGTAGCTCTGGTCTGTAACTCTGGTCTGTAGCTCTGGTCTGTAACTCTGGTCTGTAGCTCTGGTCTGTAGCTCTGGTCTGTAGCTCTGGTCTGTAACTCTGGTCTGTAG

Function


NR:

description
zinc finger protein 608-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1948302 True 240 lncRNA 0.48 1 3537212 3537451
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118942830 NA coding downstream 506744 3029349 ~ 3030468 (-)
LOC110499718 LOC106594636 coding downstream 1314012 2190139 ~ 2223200 (-)
LOC118942828 LOC106594636 coding downstream 1378256 2150983 ~ 2158956 (-)
LOC118942827 NA coding downstream 1387501 2143995 ~ 2149711 (-)
LOC110499714 LOC106609803 coding downstream 1399124 2129033 ~ 2138088 (-)
LOC110499739 grip1 coding upstream 51079 3585864 ~ 4306764 (-)
trnav-uac-23 NA coding upstream 676441 4213892 ~ 4213965 (-)
LOC110499732 dyrk2 coding upstream 1074431 4611882 ~ 4636619 (-)
LOC110516460 LOC106593189 coding upstream 1155432 4692883 ~ 4704523 (-)
LOC118942988 NA coding upstream 1185577 4723028 ~ 4728731 (-)
G1702222 NA non-coding downstream 7316 3529677 ~ 3529896 (-)
G1702221 NA non-coding downstream 7891 3529079 ~ 3529321 (-)
G1702215 NA non-coding downstream 11945 3525025 ~ 3525267 (-)
G1702209 NA non-coding downstream 33700 3502613 ~ 3503512 (-)
G1702201 NA non-coding downstream 70173 3465378 ~ 3467039 (-)
G1702172 NA non-coding upstream 26073 3563524 ~ 3565402 (-)
G1702236 NA non-coding upstream 36368 3573819 ~ 3575563 (-)
G1702237 NA non-coding upstream 36559 3574010 ~ 3574690 (-)
G1702239 LOC106599032 non-coding upstream 39895 3577346 ~ 3578436 (-)
G1702218 NA non-coding upstream 45304 3582755 ~ 3585191 (-)
G1702141 NA other downstream 18835 3281102 ~ 3518377 (-)
G1702117 NA other downstream 307171 3229002 ~ 3230041 (-)
G1701930 NA other downstream 707630 2783942 ~ 2829582 (-)
G1701824 NA other downstream 961951 2572603 ~ 2577051 (-)
G1701041 NA other downstream 1347546 2188433 ~ 2189666 (-)
G1702914 NA other upstream 904798 4442249 ~ 4444919 (-)
LOC118936570 mdm1 other upstream 1394763 4932214 ~ 4970391 (-)
G1703085 NA other upstream 1409147 4946598 ~ 4947411 (-)
G1703190 NA other upstream 1663376 5200387 ~ 5202057 (-)

Expression


G1702225 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1702225 Expression in each Bioproject

Bar chart with 8 bars.
G1702225 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network