G1704434



Basic Information


Item Value
gene id G1704434
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 7256828 ~ 7257028 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1951436
cgtctactctgtaatgtccagtaactccatgagggaacgtctactctgtgatgtctggtaactccatgagggaacgtctactctgtgatgtccagtaactccattagggaacgtctactctgtgatgtccagtaactccatgagggaacgtctactctgtgatgttcagtaactccatgagggaacgtctactctgtgatg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1951436 True 201 lncRNA 0.47 1 7256828 7257028

Neighbor


gene id symbol gene type direction distance location
LOC118942844 large1 coding upstream 377098 6712920 ~ 6879730 (+)
LOC110500907 braf coding upstream 952507 6259813 ~ 6304321 (+)
mrps33 mrps33 coding upstream 1004495 6228081 ~ 6252333 (+)
LOC110527635 LOC106590880 coding upstream 1263038 5986775 ~ 5993790 (+)
LOC118942842 LOC106575061 coding upstream 1270187 5979351 ~ 5986641 (+)
LOC118942849 arhgap8 coding downstream 270499 7527527 ~ 7561975 (+)
LOC118942991 NA coding downstream 304316 7561344 ~ 7574758 (+)
LOC110510398 LOC106591976 coding downstream 543638 7800666 ~ 7829915 (+)
LOC118942850 NA coding downstream 546252 7803280 ~ 7805680 (+)
LOC118936573 LOC105026518 coding downstream 616587 7873615 ~ 7878590 (+)
G1704433 NA non-coding upstream 1087 7255530 ~ 7255741 (+)
G1704427 NA non-coding upstream 7846 7248759 ~ 7248982 (+)
G1704426 NA non-coding upstream 9687 7246784 ~ 7247141 (+)
G1704423 NA non-coding upstream 14465 7241569 ~ 7242363 (+)
G1704420 NA non-coding upstream 15961 7240563 ~ 7240867 (+)
G1704447 NA non-coding downstream 29964 7286992 ~ 7288160 (+)
G1704446 NA non-coding downstream 32096 7289124 ~ 7289402 (+)
G1704440 NA non-coding downstream 34069 7291097 ~ 7291795 (+)
G1704443 NA non-coding downstream 48949 7305977 ~ 7353237 (+)
G1704456 NA non-coding downstream 69455 7326483 ~ 7327356 (+)
G1704409 NA other upstream 106835 7149400 ~ 7149993 (+)
G1704232 NA other upstream 249088 7007169 ~ 7007740 (+)
G1703953 NA other upstream 850055 6406032 ~ 6406773 (+)
G1704562 NA other downstream 400401 7657429 ~ 7657869 (+)
G1704651 NA other downstream 592532 7849560 ~ 7850120 (+)
LOC118942994 LOC106591951 other downstream 1281900 8538928 ~ 8564807 (+)
G1705229 NA other downstream 1593370 8850398 ~ 8851107 (+)

Expression


G1704434 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1704434 Expression in each Bioproject

Bar chart with 7 bars.
G1704434 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network