G1708635



Basic Information


Item Value
gene id G1708635
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 12951685 ~ 12952515 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1957204
caatgaacctaccaggtacctccccaaagccttaaacacgggcaccctcatagatatcatcctaaccaacttcccctctaaatacacctctgctgtcttcaaccaagatctcagcgatcactgcctcattgcctgcatccgtaatgggtcagcggtcaaacgacctcctctcatcactgtaaaacgctccctgaaacacttcagcgagcaggcctttctaatcgacctggccggggtatcctggaaggatattgacctcatcccgtcagtagaggatgcctggatatttttaaaaaatgccttcctaaccatcttaaataaacatgccccattcaagaaatttagaaccaggaacagatatagcccttggttctccccagacctgactgcccttaaccaacacaaaaacatcctatggcgttctgcattagcatcgaacagcccccgtgatatgcagctgttcagggaagctagaaaccattatacacaggcagttagaaaagccaaggctagctttttcaagcagaaatttgcttcttgcaacactaactcaaaaaagttctgggacactgtaaagtccatggagaataagaacacctcctcccagctgcccactgcactgaagataggaaacactgtcaccactgataaatccaccataattgaaaatttcaataagcatttttctactgctggccatgctttccacctggctactcctacccctgtcaacagcactgcacccccaacagcaactcgcccaagccttccccatttctccttctcccaaatccattcagctgatgttctgaaagagctgcaaaatctgaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1957204 True 831 TUCP 0.47 1 12951685 12952515

Neighbor


gene id symbol gene type direction distance location
cmas cmas coding upstream 65915 12867488 ~ 12885849 (+)
LOC118942883 LOC106596479 coding upstream 91317 12844103 ~ 12860368 (+)
LOC118943029 NA coding upstream 109163 12771599 ~ 12842545 (+)
LOC110516535 LOC106576596 coding upstream 114448 12829169 ~ 12837237 (+)
LOC110490810 LOC106576597 coding upstream 125931 12745000 ~ 12825754 (+)
LOC118942885 LOC106576602 coding downstream 18398 12970913 ~ 12974793 (+)
LOC110490630 LOC106609716 coding downstream 62651 13015166 ~ 13034215 (+)
LOC110490636 LOC106576583 coding downstream 84717 13037232 ~ 13051496 (+)
LOC110490642 LOC106597584 coding downstream 99332 13051847 ~ 13058457 (+)
LOC110518396 LOC106609712 coding downstream 106190 13058705 ~ 13066794 (+)
G1708602 NA non-coding upstream 44602 12901283 ~ 12907083 (+)
G1708492 NA non-coding upstream 180298 12770722 ~ 12771387 (+)
G1708410 NA non-coding upstream 218743 12712997 ~ 12732942 (+)
G1708643 NA non-coding downstream 7946 12960461 ~ 12960856 (+)
G1708646 NA non-coding downstream 12026 12964541 ~ 12964769 (+)
G1708650 NA non-coding downstream 26616 12979131 ~ 12979348 (+)
G1708651 NA non-coding downstream 29263 12981778 ~ 12982204 (+)
G1708652 NA non-coding downstream 29974 12982489 ~ 12982769 (+)
G1708495 NA other upstream 166183 12784207 ~ 12785502 (+)
G1708367 NA other upstream 300108 12649686 ~ 12651577 (+)
G1708323 NA other upstream 367529 12578608 ~ 12584156 (+)
G1708014 NA other upstream 701561 12248028 ~ 12250124 (+)
G1708702 NA other downstream 147326 13099841 ~ 13101833 (+)
G1709276 zdhhc17 other downstream 803671 13756186 ~ 13765456 (+)
LOC110499758 osbpl8 other downstream 968043 13794979 ~ 13950916 (+)
G1709592 NA other downstream 1113334 14065849 ~ 14066683 (+)

Expression


G1708635 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1708635 Expression in each Bioproject

Bar chart with 20 bars.
G1708635 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network