G1708646



Basic Information


Item Value
gene id G1708646
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 12964541 ~ 12964769 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1957215
cactcacagggccctacacactcactccatcatctgctcactcacacataatatgcacatacatttatactgattatacacacccactcacatacaagctgctgctactctgtttatcttatatcctgttgcctagtcacctttcccctatacatatctacctccatcacaccagtatccctgcacattataaatatggtattggaactgaccctgtatatagaatact

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1957215 True 229 lncRNA 0.41 1 12964541 12964769
Loading

Neighbor


gene id symbol gene type direction distance location
cmas cmas coding upstream 78771 12867488 ~ 12885849 (+)
LOC118942883 LOC106596479 coding upstream 104173 12844103 ~ 12860368 (+)
LOC118943029 NA coding upstream 122019 12771599 ~ 12842545 (+)
LOC110516535 LOC106576596 coding upstream 127304 12829169 ~ 12837237 (+)
LOC110490810 LOC106576597 coding upstream 138787 12745000 ~ 12825754 (+)
LOC118942885 LOC106576602 coding downstream 6144 12970913 ~ 12974793 (+)
LOC110490630 LOC106609716 coding downstream 50397 13015166 ~ 13034215 (+)
LOC110490636 LOC106576583 coding downstream 72463 13037232 ~ 13051496 (+)
LOC110490642 LOC106597584 coding downstream 87078 13051847 ~ 13058457 (+)
LOC110518396 LOC106609712 coding downstream 93936 13058705 ~ 13066794 (+)
G1708643 NA non-coding upstream 3685 12960461 ~ 12960856 (+)
G1708602 NA non-coding upstream 57458 12901283 ~ 12907083 (+)
G1708492 NA non-coding upstream 193154 12770722 ~ 12771387 (+)
G1708650 NA non-coding downstream 14362 12979131 ~ 12979348 (+)
G1708651 NA non-coding downstream 17009 12981778 ~ 12982204 (+)
G1708652 NA non-coding downstream 17720 12982489 ~ 12982769 (+)
G1708674 NA non-coding downstream 34681 12999450 ~ 12999709 (+)
G1708683 NA non-coding downstream 110160 13074929 ~ 13079923 (+)
G1708635 NA other upstream 12026 12951685 ~ 12952515 (+)
G1708495 NA other upstream 179039 12784207 ~ 12785502 (+)
G1708367 NA other upstream 312964 12649686 ~ 12651577 (+)
G1708323 NA other upstream 380385 12578608 ~ 12584156 (+)
G1708702 NA other downstream 135072 13099841 ~ 13101833 (+)
G1709276 zdhhc17 other downstream 791417 13756186 ~ 13765456 (+)
LOC110499758 osbpl8 other downstream 955789 13794979 ~ 13950916 (+)
G1709592 NA other downstream 1101080 14065849 ~ 14066683 (+)

Expression


G1708646 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1708646 Expression in each Bioproject

Bar chart with 19 bars.
G1708646 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network