G1708753



Basic Information


Item Value
gene id G1708753
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 13196916 ~ 13197213 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1957365
TTAGAGTAGAGCAAGGTCTAAGACATGCAGTGTGTTTAGTTAACATGCAGACCCACTAGGCAGGAATACATAGCAGTAGATGTACTATGACTTGACAGATACCTGACCTGCAACACCAAAGCTACGTTATAACACGGCATCATTTCCCAAGGACATCATCCACATTACATTTCCCAAGGACATCATCCACATTACATTTCCCAAGGACATCATCCACATTACATTTCCCAAGGACATCATCCACATTACATTTCCCAAGGACATCATCCACATTACATTTCTCAAGGACATCATCCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1957365 True 298 lncRNA 0.42 1 13196916 13197213

Neighbor


gene id symbol gene type direction distance location
LOC110490647 LOC106576589 coding upstream 122547 13070036 ~ 13074369 (+)
LOC110518396 LOC106609712 coding upstream 130122 13058705 ~ 13066794 (+)
LOC110490642 LOC106597584 coding upstream 138459 13051847 ~ 13058457 (+)
LOC110490636 LOC106576583 coding upstream 145420 13037232 ~ 13051496 (+)
LOC110490630 LOC106609716 coding upstream 162701 13015166 ~ 13034215 (+)
LOC110490653 ctrb coding downstream 30585 13227798 ~ 13229394 (+)
LOC118942887 NA coding downstream 33862 13231075 ~ 13231826 (+)
LOC110500963 LOC106609744 coding downstream 501304 13698517 ~ 13725137 (+)
crp crp coding downstream 541845 13739058 ~ 13748205 (+)
LOC110499758 osbpl8 coding downstream 597766 13794979 ~ 13950916 (+)
G1708736 NA non-coding upstream 42300 13154298 ~ 13154616 (+)
G1708734 NA non-coding upstream 45175 13151536 ~ 13151741 (+)
G1708732 NA non-coding upstream 47215 13149378 ~ 13149701 (+)
G1708730 NA non-coding upstream 49414 13147270 ~ 13147502 (+)
G1708712 NA non-coding upstream 78231 13117731 ~ 13118685 (+)
G1708761 NA non-coding downstream 22762 13219975 ~ 13220710 (+)
G1708762 NA non-coding downstream 29239 13226452 ~ 13226775 (+)
G1708827 NA non-coding downstream 180632 13377845 ~ 13402223 (+)
G1708840 NA non-coding downstream 207627 13404840 ~ 13405199 (+)
G1708841 NA non-coding downstream 209203 13406416 ~ 13406651 (+)
G1708702 NA other upstream 95083 13099841 ~ 13101833 (+)
G1708635 NA other upstream 244401 12951685 ~ 12952515 (+)
LOC110490810 LOC106576597 other upstream 383188 12745000 ~ 12825754 (+)
G1708495 NA other upstream 411414 12784207 ~ 12785502 (+)
G1709276 zdhhc17 other downstream 558973 13756186 ~ 13765456 (+)
G1709592 NA other downstream 868636 14065849 ~ 14066683 (+)
LOC118942889 LOC106609776 other downstream 1337170 14533785 ~ 14548855 (+)
G1709824 NA other downstream 1458474 14655687 ~ 14657284 (+)

Expression


G1708753 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1708753 Expression in each Bioproject

Bar chart with 11 bars.
G1708753 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network