G1708844


Basic Information

Item Value
gene id G1708844
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 13418478 ~ 13418693 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1957457
gtgttaatgtaaccccgttggaacacaagaccatgtgtgttaatgtaaccccgttggaacacaagaccatgtgtgttaatgtaaccccgttggaacacaagaccatgtgtgttaatgtaaccccgttggaacaccagaccatgtgtgttaatgtaaccccgttggaacacaagaccatgtgtgttaatgtaaccccgttggaacacaagaccatgt

Function

NR:

description
deleted in lung and esophageal cancer protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1957457 True 216 lncRNA 0.45 1 13418478 13418693

Neighbor

gene id symbol gene type direction distance location
LOC118942887 NA coding upstream 186652 13231075 ~ 13231826 (+)
LOC110490653 ctrb coding upstream 189084 13227798 ~ 13229394 (+)
LOC110490647 LOC106576589 coding upstream 344109 13070036 ~ 13074369 (+)
LOC110518396 LOC106609712 coding upstream 351684 13058705 ~ 13066794 (+)
LOC110490642 LOC106597584 coding upstream 360021 13051847 ~ 13058457 (+)
LOC110500963 LOC106609744 coding downstream 279824 13698517 ~ 13725137 (+)
crp crp coding downstream 320365 13739058 ~ 13748205 (+)
LOC110499758 osbpl8 coding downstream 376286 13794979 ~ 13950916 (+)
LOC110516615 LOC106576514 coding downstream 568539 13987232 ~ 14007450 (+)
LOC118943011 NA coding downstream 579503 13998196 ~ 13998336 (+)
G1708841 NA non-coding upstream 11827 13406416 ~ 13406651 (+)
G1708840 NA non-coding upstream 13279 13404840 ~ 13405199 (+)
G1708827 NA non-coding upstream 16255 13377845 ~ 13402223 (+)
G1708762 NA non-coding upstream 191703 13226452 ~ 13226775 (+)
G1708761 NA non-coding upstream 197768 13219975 ~ 13220710 (+)
G1708846 NA non-coding downstream 4289 13422982 ~ 13423183 (+)
G1708848 NA non-coding downstream 6977 13425670 ~ 13425940 (+)
G1708855 NA non-coding downstream 26988 13445681 ~ 13445975 (+)
G1708856 NA non-coding downstream 28660 13447353 ~ 13447631 (+)
G1708863 NA non-coding downstream 40909 13459602 ~ 13460407 (+)
G1708702 NA other upstream 316645 13099841 ~ 13101833 (+)
G1708635 NA other upstream 465963 12951685 ~ 12952515 (+)
LOC110490810 LOC106576597 other upstream 604750 12745000 ~ 12825754 (+)
G1708495 NA other upstream 632976 12784207 ~ 12785502 (+)
G1709276 zdhhc17 other downstream 337493 13756186 ~ 13765456 (+)
G1709592 NA other downstream 647156 14065849 ~ 14066683 (+)
LOC118942889 LOC106609776 other downstream 1115690 14533785 ~ 14548855 (+)
G1709824 NA other downstream 1236994 14655687 ~ 14657284 (+)

Expression


Co-expression Network