G1709755



Basic Information


Item Value
gene id G1709755
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 14447612 ~ 14447875 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1958566
TAATATCCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATATCCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATATCCATCCAGGGACTATGTTTAATATTCATCCAGGGACTATGTTTAATCCAGGGACTATGTTTAATAT

Function


NR:

description
uncharacterized protein LOC110513291

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1958566 True 264 lncRNA 0.34 1 14447612 14447875
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499784 kcnc2 coding upstream 69569 14295967 ~ 14378043 (+)
LOC110499776 LOC106609772 coding upstream 159492 14282052 ~ 14288120 (+)
LOC110499766 LOC106576530 coding upstream 320026 14116546 ~ 14127586 (+)
LOC110500967 LOC106609789 coding upstream 331817 14103817 ~ 14115795 (+)
LOC118942888 NA coding upstream 429302 14017709 ~ 14018310 (+)
LOC110499786 pmpcb coding downstream 30380 14478255 ~ 14482429 (+)
LOC110499788 psmc2 coding downstream 40543 14488418 ~ 14493003 (+)
LOC110499790 tspan33 coding downstream 66544 14514419 ~ 14533522 (+)
LOC118942889 LOC106609776 coding downstream 85910 14533785 ~ 14548855 (+)
LOC110490791 LOC106609779 coding downstream 101642 14549517 ~ 14565204 (+)
G1709756 NA non-coding upstream 80 14446012 ~ 14447532 (+)
G1709751 NA non-coding upstream 7453 14430220 ~ 14440159 (+)
G1709752 NA non-coding upstream 13149 14430452 ~ 14434463 (+)
G1709749 NA non-coding upstream 20474 14426746 ~ 14427138 (+)
G1709743 NA non-coding upstream 31869 14415467 ~ 14415743 (+)
G1709761 NA non-coding downstream 16788 14464663 ~ 14464886 (+)
G1709767 NA non-coding downstream 47029 14494904 ~ 14495399 (+)
G1709776 NA non-coding downstream 60445 14508320 ~ 14523155 (+)
G1709793 NA non-coding downstream 68817 14516692 ~ 14518026 (+)
G1709797 NA non-coding downstream 75511 14523386 ~ 14523944 (+)
G1709592 NA other upstream 380929 14065849 ~ 14066683 (+)
LOC110499758 osbpl8 other upstream 496696 13794979 ~ 13950916 (+)
G1709276 zdhhc17 other upstream 682156 13756186 ~ 13765456 (+)
G1708702 NA other upstream 1345779 13099841 ~ 13101833 (+)
LOC110490642 LOC106597584 other upstream 1393643 13051847 ~ 13058457 (+)
G1709824 NA other downstream 207812 14655687 ~ 14657284 (+)
G1709840 NA other downstream 231607 14679482 ~ 14682208 (+)
G1710321 NA other downstream 685257 15133132 ~ 15133588 (+)
LOC110499821 LOC106609608 other downstream 1031273 15462544 ~ 15700037 (+)

Expression


G1709755 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1709755 Expression in each Bioproject

Bar chart with 9 bars.
G1709755 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network