G1713834



Basic Information


Item Value
gene id G1713834
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 18886535 ~ 18887201 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1963520
GTGAAAGAGAAGGTGAGTGAAAGAGAAGGTGAATGAAAGAGAAGGTGAATGAAAGAGAAGGTGAGTGAAAGAGAAGGTGAATGAAAGAGAAGGTGAGTGAAAGAGAAGGTGAATGAAAGAGAAGGTGAATGAAAGAGAAGGTAAATGAAAGTGAAGGTGAATGAAAGTGAAAGAGAAGGTGAATGAAAGTGAAAGAGAAGGTGAATGAAAGTGAAAGAGAAGGTGAGTGAAAGAGAAGGTGAATGAAAGAGAAGGTGAGTGAAAGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1963520 True 267 lncRNA 0.39 2 18886535 18887201

Neighbor


gene id symbol gene type direction distance location
LOC110499902 LOC106609566 coding upstream 46075 18770248 ~ 18840460 (+)
LOC110499903 LOC106609567 coding upstream 116003 18758459 ~ 18770532 (+)
LOC110499901 LOC106609586 coding upstream 131890 18740386 ~ 18754645 (+)
LOC110499900 LOC106596632 coding upstream 152483 18726697 ~ 18734052 (+)
fut9 fut9 coding upstream 165943 18719308 ~ 18720592 (+)
LOC110501017 LOC106609562 coding downstream 336236 19223437 ~ 19226634 (+)
LOC118942896 NA coding downstream 373544 19260745 ~ 19279035 (+)
bik LOC106609559 coding downstream 415167 19302368 ~ 19306083 (+)
LOC110499913 NA coding downstream 444763 19331964 ~ 19337651 (+)
LOC118942905 NA coding downstream 497791 19384992 ~ 19388072 (+)
G1713830 NA non-coding upstream 4877 18880801 ~ 18881658 (+)
G1713825 NA non-coding upstream 14771 18870436 ~ 18871764 (+)
G1713824 NA non-coding upstream 16840 18867440 ~ 18869695 (+)
G1713820 NA non-coding upstream 20374 18863706 ~ 18866161 (+)
G1713818 NA non-coding upstream 23281 18863014 ~ 18863254 (+)
G1713942 NA non-coding downstream 257744 19144945 ~ 19146135 (+)
G1713990 NA non-coding downstream 273084 19160285 ~ 19160808 (+)
G1713953 NA non-coding downstream 286906 19174107 ~ 19176169 (+)
G1714034 NA non-coding downstream 346924 19234125 ~ 19234357 (+)
G1714035 NA non-coding downstream 347637 19234838 ~ 19235054 (+)
G1713384 NA other upstream 149099 18734791 ~ 18737436 (+)
G1713262 NA other upstream 385661 18497147 ~ 18500874 (+)
si:dkey-159a18.1 LOC106609576 other upstream 619027 18247128 ~ 18268691 (+)
G1712658 NA other upstream 1217949 17666280 ~ 17668586 (+)
LOC110501009 LOC105020375 other upstream 1942746 16914013 ~ 16973778 (+)
G1714090 NA other downstream 497771 19384972 ~ 19754609 (+)
nmes1 nmes1 other downstream 1221997 20109125 ~ 20113891 (+)
G1715392 NA other downstream 1671221 20558422 ~ 20558751 (+)
LOC110499980 LOC106576426 other downstream 2111397 20954576 ~ 21004439 (+)
G1717161 LOC106576319 other downstream 3288762 22175963 ~ 22180897 (+)

Expression


G1713834 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1713834 Expression in each Bioproject

Bar chart with 11 bars.
G1713834 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network