G1718385



Basic Information


Item Value
gene id G1718385
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 23159239 ~ 23159905 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1968739
GCATCAGCTTAGCATTTTATTTAAGTTCTTCAATTGCACATTGCAAAACAAGCAGTGTAACACCAAAGCCACTTCTTGGCTACAAACTTTCTTCAATATCCAATATGACGTATTAATTATATTACTTATTTGCGTTTAAGGTTTGTAGTGAACACTAAAACGAAGATTTTTGCAAATCTTTAATTTTTAATTTGCAGTGTAAACAATGGGGAATGTTCTATATGATTCAAGTCTACTTCTAATCAAAGAATCCGAAAATGGATCTCGATAGTAGCCCAATGCTGCTATGCTAACTTAGACATTGACCCACAATGCATGACTGTCGCTTTGCCTGTGCTTGTAGCTACTTTAAGGTTTAAATAATGTAACAAGTCTGTGTCTTTCTAGATTTTGCCCCACCAACGGGGATTTGGCCATACTGTTTCATACTGCAGCCATCTACAGCTCTACCGTTACCACTTCTCTTCACGGGAGCTATGTAGCCGCAGCACGCACAAACAAGCCTCTTGTGGCACATGATGTAGTCTCTCTCATTCCATCCGCAACGCTCATAGAACGTTGGGCAGATAGAGGGAGCAGAGTAGCATATTCTGGCCCAGCGCGGGGAAGCGTCTGAAGGCCTCCCAGGCGTCTGAGAAGATGTTGTACTTGAGGAAGACGCGGTGCT

Function


NR:

description
kelch-like protein 42, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1968739 True 667 lncRNA 0.42 1 23159239 23159905

Neighbor


gene id symbol gene type direction distance location
LOC110501030 LOC106609435 coding downstream 5733 23141591 ~ 23153506 (-)
LOC110500044 tsn9 coding downstream 21087 23133989 ~ 23138152 (-)
LOC118943006 amdhd1 coding downstream 48637 23108483 ~ 23110665 (-)
ntn4 LOC106609442 coding downstream 66628 23072015 ~ 23092611 (-)
LOC110500040 LOC106576294 coding downstream 105567 23041298 ~ 23053672 (-)
LOC110501032 itfg2 coding upstream 19822 23179727 ~ 23212378 (-)
LOC118936407 itfg2 coding upstream 53162 23213067 ~ 23215065 (-)
trnaa-ugc-147 NA coding upstream 91854 23251759 ~ 23251832 (-)
LOC118942912 NA coding upstream 104580 23264485 ~ 23269610 (-)
nup37 nup37 coding upstream 169681 23329586 ~ 23340572 (-)
G1718421 LOC106609448 non-coding downstream 909 23157132 ~ 23158330 (-)
G1718386 NA non-coding downstream 31742 23123414 ~ 23127497 (-)
G1718381 amdhd1 non-coding downstream 55214 23102613 ~ 23104025 (-)
G1718415 LOC106576293 non-coding downstream 58437 23099015 ~ 23100802 (-)
G1718458 NA non-coding upstream 94719 23254624 ~ 23254869 (-)
G1718479 NA non-coding upstream 96981 23256886 ~ 23257214 (-)
G1718478 NA non-coding upstream 98827 23258732 ~ 23259044 (-)
G1718477 NA non-coding upstream 99477 23259382 ~ 23259971 (-)
G1718481 NA non-coding upstream 101768 23261673 ~ 23261954 (-)
G1718397 NA other downstream 101420 23057381 ~ 23057819 (-)
G1718181 NA other downstream 193362 22882496 ~ 22965877 (-)
igf1 LOC100136517 other upstream 206195 23366099 ~ 23386794 (-)
G1718586 NA other upstream 322145 23482050 ~ 23483029 (-)
G1718710 NA other upstream 413415 23573320 ~ 23574041 (-)
LOC110500069 LOC106609440 other upstream 415021 23574474 ~ 23586547 (-)
G1718713 NA other upstream 422670 23582575 ~ 23582850 (-)

Expression


G1718385 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1718385 Expression in each Bioproject

Bar chart with 12 bars.
G1718385 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network