G1718479



Basic Information


Item Value
gene id G1718479
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 23256886 ~ 23257214 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1968849
agagggtggtctatagcaggcggcaacggtgagagacttgttgttagagaggtggatttttaaaagtagaagttcaaattgtttgggtacagacctggatagtaggacagaactctgcaggctatctttgcagtagattgcaacaccgccccctttggcagttctatcttgtctggaaatgttgtagtttgggattaacatttttggtggtcttcctaagccaggattcagacacagctagaacatccgggttggcagagtgtgctaaagcagtgaatagaacaaacttagggaggaggcttctaatgttaacatgcatgaaaccaagg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1968849 True 329 lncRNA 0.45 1 23256886 23257214

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-147 NA coding downstream 5054 23251759 ~ 23251832 (-)
LOC118936407 itfg2 coding downstream 41821 23213067 ~ 23215065 (-)
LOC110501032 itfg2 coding downstream 44508 23179727 ~ 23212378 (-)
LOC110501030 LOC106609435 coding downstream 103380 23141591 ~ 23153506 (-)
LOC110500044 tsn9 coding downstream 118734 23133989 ~ 23138152 (-)
LOC118942912 NA coding upstream 7271 23264485 ~ 23269610 (-)
nup37 nup37 coding upstream 72372 23329586 ~ 23340572 (-)
LOC110500053 LOC106609478 coding upstream 95381 23352595 ~ 23355101 (-)
igf1 LOC100136517 coding upstream 108885 23366099 ~ 23386794 (-)
LOC110500055 dram1 coding upstream 140652 23397866 ~ 23403408 (-)
G1718458 NA non-coding downstream 2017 23254624 ~ 23254869 (-)
G1718385 NA non-coding downstream 96981 23159239 ~ 23159905 (-)
G1718421 LOC106609448 non-coding downstream 98556 23157132 ~ 23158330 (-)
G1718386 NA non-coding downstream 129389 23123414 ~ 23127497 (-)
LOC118943006 amdhd1 non-coding downstream 146221 23108483 ~ 23110665 (-)
G1718478 NA non-coding upstream 1518 23258732 ~ 23259044 (-)
G1718477 NA non-coding upstream 2168 23259382 ~ 23259971 (-)
G1718481 NA non-coding upstream 4459 23261673 ~ 23261954 (-)
G1718482 NA non-coding upstream 5501 23262715 ~ 23263258 (-)
G1718499 NA non-coding upstream 53942 23311156 ~ 23312325 (-)
ntn4 LOC106609442 other downstream 183929 23072015 ~ 23092611 (-)
G1718397 NA other downstream 199067 23057381 ~ 23057819 (-)
LOC110500040 LOC106576294 other downstream 203298 23041298 ~ 23053672 (-)
G1718181 NA other downstream 291009 22882496 ~ 22965877 (-)
G1718586 NA other upstream 224836 23482050 ~ 23483029 (-)
G1718710 NA other upstream 316106 23573320 ~ 23574041 (-)
LOC110500069 LOC106609440 other upstream 317712 23574474 ~ 23586547 (-)
G1718713 NA other upstream 325361 23582575 ~ 23582850 (-)

Expression


G1718479 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1718479 Expression in each Bioproject

Bar chart with 17 bars.
G1718479 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network