G1719420



Basic Information


Item Value
gene id G1719420
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 24160862 ~ 24161102 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1969908
gcgatatgatggctgcgtggtcccatggtgtttatacttgcatactattgtttgtacagatgaacgtggtaccttcaggcttttggaaattgctcccaaggatgaaccagacttgtggaggtctacgattttttttctgaggtcttggctgatttcttttgattttcccatgatgtcaatcaaagaggcactgagtttgaaggtaggccttgaaatacatccacaggtacacctctaattg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1969908 True 241 lncRNA 0.43 1 24160862 24161102

Neighbor


gene id symbol gene type direction distance location
LOC110501035 LOC106609376 coding downstream 48937 24110656 ~ 24111925 (-)
LOC110501034 NA coding downstream 79578 24079789 ~ 24081284 (-)
LOC110500092 LOC106609371 coding downstream 94451 24060587 ~ 24066411 (-)
LOC110500089 LOC106609371 coding downstream 117246 24037871 ~ 24043628 (-)
LOC110500091 LOC106609456 coding downstream 123744 24021902 ~ 24037118 (-)
LOC110501036 cbll1 coding upstream 3959 24164958 ~ 24177940 (-)
LOC110500094 LOC106609364 coding upstream 30557 24191659 ~ 24267164 (-)
LOC110500098 LOC106609359 coding upstream 160700 24321802 ~ 24330147 (-)
LOC110500100 glt8d2 coding upstream 213920 24375022 ~ 24381449 (-)
LOC110500106 LOC106609352 coding upstream 320038 24481140 ~ 24517204 (-)
G1719412 NA non-coding downstream 12778 24147159 ~ 24148084 (-)
G1719406 NA non-coding downstream 24779 24134441 ~ 24136083 (-)
G1719402 NA non-coding downstream 31783 24128874 ~ 24129079 (-)
G1719401 NA non-coding downstream 34298 24126356 ~ 24126564 (-)
G1719370 NA non-coding downstream 86202 24074209 ~ 24074660 (-)
G1719422 NA non-coding upstream 1820 24162922 ~ 24163245 (-)
G1719426 NA non-coding upstream 8675 24169777 ~ 24170012 (-)
G1719464 NA non-coding upstream 107980 24269082 ~ 24269384 (-)
G1719469 NA non-coding upstream 112335 24273437 ~ 24273751 (-)
G1719407 NA other downstream 15514 24137726 ~ 24145348 (-)
G1718713 NA other downstream 578012 23582575 ~ 23582850 (-)
LOC110500069 LOC106609440 other downstream 584112 23574474 ~ 23586547 (-)
LOC110500148 LOC106609286 other upstream 2140640 26301474 ~ 26310640 (-)
LOC110501044 LOC106609327 other upstream 3764315 27924301 ~ 27929621 (-)
LOC110501045 LOC106609328 other upstream 3921711 28002248 ~ 28103013 (-)
G1723535 NA other upstream 4069421 28230523 ~ 28230880 (-)
G1723713 utp20 other upstream 4208516 28369618 ~ 28371062 (-)

Expression


G1719420 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1719420 Expression in each Bioproject

Bar chart with 21 bars.
G1719420 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network