G1725440



Basic Information


Item Value
gene id G1725440
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 30143786 ~ 30181651 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1976595
gcactcaattagtatttggtagcaatgcctttaaatagtttgccttgggtcaaacgtttcgagtaacctatcacaagcttcccacaataagttgggtaaattttggcccattcctcttgacagagctgttgtaactgagtcaggtttgtaggcttccttgctcgcacacactttttcagttcagcccacaaattttctataggattgaggtcagtgctttgtgatggctactccaataccttgactttgttgtccttaagccattttaccacaactttggaagtatgcttggggtcaatgtctatttggaagacccatctgcgaccaagcttaaactttctgactgatgtcttgagatgttgcttcaatatatccacataattttccttcgtcatgatgccatctattttgtgaagtgcaccagtccgtcctgcagcaaaacacccccac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1976595 True 450 lncRNA 0.42 2 30143786 30181651
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500213 LOC106609216 coding upstream 5423 30135626 ~ 30138363 (+)
LOC110500214 cssa17h12orf56 coding upstream 8241 30131073 ~ 30135545 (+)
LOC110501059 LOC106609213 coding upstream 30607 30099370 ~ 30113179 (+)
cin cin coding upstream 68606 30073447 ~ 30075203 (+)
LOC110500210 LOC106609211 coding upstream 134200 30002404 ~ 30009586 (+)
LOC110500216 LOC106609220 coding downstream 82448 30264099 ~ 30410281 (+)
LOC110500929 rs3a coding downstream 362739 30544390 ~ 30545166 (+)
LOC110500218 tnni1 coding downstream 536929 30718580 ~ 30725274 (+)
LOC110500219 LOC105029072 coding downstream 568359 30750010 ~ 30807982 (+)
LOC110500220 tnnt2 coding downstream 626510 30808161 ~ 30821295 (+)
G1725438 NA non-coding upstream 12724 30130753 ~ 30131062 (+)
G1725436 NA non-coding upstream 14656 30128864 ~ 30129130 (+)
G1725432 NA non-coding upstream 18902 30124673 ~ 30124884 (+)
G1725360 NA non-coding upstream 184495 29959083 ~ 29959291 (+)
G1725464 NA non-coding downstream 19947 30201598 ~ 30203607 (+)
G1725474 NA non-coding downstream 44319 30225970 ~ 30226172 (+)
G1725475 NA non-coding downstream 45020 30226671 ~ 30226875 (+)
G1725481 NA non-coding downstream 64890 30246541 ~ 30246855 (+)
G1725840 NA non-coding downstream 115162 30296813 ~ 30297582 (+)
G1725312 LOC106576088 other upstream 251829 29890286 ~ 29891957 (+)
G1724262 LOC106609200 other upstream 883857 29256778 ~ 29259929 (+)
G1724234 LOC106609199 other upstream 929503 29209169 ~ 29214283 (+)
LOC110500183 LOC106609180 other upstream 1800052 28341423 ~ 28343734 (+)
LOC110501048 LOC106609163 other upstream 1819169 28311018 ~ 28335924 (+)
G1726209 LOC106609221 other downstream 400351 30582002 ~ 30590636 (+)
G1726222 NA other downstream 423649 30605300 ~ 30611361 (+)
LOC110500226 LOC106576059 other downstream 700192 30881776 ~ 30889293 (+)
G1726863 NA other downstream 958946 31140597 ~ 31141090 (+)
G1727146 NA other downstream 1267745 31449396 ~ 31450117 (+)

Expression


G1725440 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1725440 Expression in each Bioproject

Bar chart with 19 bars.
G1725440 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network