G1727220



Basic Information


Item Value
gene id G1727220
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 31564135 ~ 31564594 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1978507
ggtgaagcgtgttggtggcagcatcatgccgtggggatgtttttcagtggcagggactgggagactattcaggatcgaggtaaagatgaacggagcaaagtacagagacctccttgatgaaaacctgctccagagcactcaggacctcagactgggtcgaaggttcaccttccagcaggacaacgaccctaagcacacagccaagacaacgcaggagtggcttcggaacaagtctctgaatgtctttgagtggcctagccagagccttgacttgaacccgatcgaacatctctggagatatctgaaaatagctgtgcagcaatgctccccatccaacctgacagagcttgagaggatatgtaaagaggaatgggagaaactccccaaatacaggtaccaggcttgtagcgtcatacccaagaagactcaaggctgtaatcgctgccaaaggtgcatcaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1978507 True 460 TUCP 0.51 1 31564135 31564594

Neighbor


gene id symbol gene type direction distance location
LOC110500240 LOC106609248 coding upstream 66305 31493462 ~ 31497830 (+)
LOC118942919 NA coding upstream 98288 31464252 ~ 31465847 (+)
LOC110500239 LOC106609244 coding upstream 127296 31427827 ~ 31436839 (+)
trnaa-ugc-149 NA coding upstream 459923 31104142 ~ 31104212 (+)
LOC110500235 LOC106609242 coding upstream 498484 31046030 ~ 31065651 (+)
tmem168a LOC106609249 coding downstream 3801 31568395 ~ 31589029 (+)
LOC110500245 LOC106609252 coding downstream 116346 31680940 ~ 31684896 (+)
LOC110500244 LOC106609251 coding downstream 120813 31685407 ~ 31736831 (+)
LOC110500247 LOC106609254 coding downstream 181179 31745773 ~ 31800121 (+)
LOC110500249 timp3 coding downstream 308954 31873548 ~ 31894544 (+)
G1727215 NA non-coding upstream 11346 31552493 ~ 31552789 (+)
G1727204 NA non-coding upstream 30546 31533328 ~ 31533589 (+)
G1727203 NA non-coding upstream 31880 31532018 ~ 31532255 (+)
G1727200 NA non-coding upstream 35425 31528482 ~ 31528710 (+)
G1727195 NA non-coding upstream 40482 31523412 ~ 31523653 (+)
G1727224 NA non-coding downstream 3361 31567955 ~ 31568161 (+)
G1727427 NA non-coding downstream 36197 31600791 ~ 31601136 (+)
G1727468 NA non-coding downstream 93761 31658355 ~ 31658590 (+)
G1727480 NA non-coding downstream 113884 31678478 ~ 31678731 (+)
LOC110501063 LOC106609150 non-coding downstream 578570 32114413 ~ 32144886 (+)
G1727181 NA other upstream 55763 31508056 ~ 31508372 (+)
G1727146 NA other upstream 114018 31449396 ~ 31450117 (+)
G1726863 NA other upstream 423045 31140597 ~ 31141090 (+)
LOC110500226 LOC106576059 other upstream 680522 30881776 ~ 30889293 (+)
G1726222 NA other upstream 952774 30605300 ~ 30611361 (+)
LOC110500252 LOC106609149 other downstream 593318 32153116 ~ 32162456 (+)
G1729465 NA other downstream 1756859 33321453 ~ 33321761 (+)
LOC110500285 fam19a5 other downstream 2145498 33709461 ~ 33869016 (+)
G1732028 NA other downstream 3874695 35439289 ~ 35484354 (+)

Expression


G1727220 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1727220 Expression in each Bioproject

Bar chart with 20 bars.
G1727220 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network