G1727426 (LOC107662719)



Basic Information


Item Value
gene id G1727426
gene name LOC107662719
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 31599146 ~ 31599489 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1978738
gccaaagggggggaaatatcaccatgtgtgctgcaatggccaatgatggtttgcttctcaacacaccactcattggcccatacaacacagaaaggcttatagctttcctagaacagctctatgctcagctagtgccagcagaacagggggagccagtaagaaacccacaagtttttgtcatagtttgcgataacgttgcttttcaccactctgcagctgtcacagattggtttgcagcacatcacagatttatggttttgtacctgcctgcatattcacccttcctcaacccaacagaggagtttttctctgcctggaggtggaaagtgtttggtcaccaccca

Function


NR:

description
PREDICTED: insertion element IS630 uncharacterized 39 kDa protein-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1978738 True 344 TUCP 0.48 1 31599146 31599489

Neighbor


gene id symbol gene type direction distance location
LOC110501061 LOC106609245 coding downstream 173825 31309021 ~ 31425321 (-)
LOC110500238 LOC106609243 coding downstream 322867 31248021 ~ 31276279 (-)
LOC110500234 LOC106609240 coding downstream 589945 30998435 ~ 31009201 (-)
LOC110500232 strip2 coding downstream 613053 30977076 ~ 30986093 (-)
LOC118942918 NA coding downstream 691366 30905417 ~ 30907780 (-)
LOC110500243 LOC106609250 coding upstream 49251 31648740 ~ 31657995 (-)
LOC110500248 LOC106576044 coding upstream 224202 31823691 ~ 31948782 (-)
LOC110501062 LOC100286412 coding upstream 353118 31952607 ~ 31982502 (-)
LOC110500250 LOC106609152 coding upstream 445721 32045210 ~ 32048228 (-)
LOC110500251 cssa07h12orf66 coding upstream 545734 32145223 ~ 32153035 (-)
G1727421 NA non-coding downstream 3619 31595120 ~ 31595527 (-)
G1727359 LOC106609249 non-coding downstream 13817 31584651 ~ 31585329 (-)
G1727401 NA non-coding downstream 34789 31564148 ~ 31564357 (-)
G1727397 NA non-coding downstream 42224 31556710 ~ 31556922 (-)
G1727396 NA non-coding downstream 43537 31555357 ~ 31555609 (-)
G1727428 NA non-coding upstream 1305 31600794 ~ 31601119 (-)
G1727510 NA non-coding upstream 38402 31637891 ~ 31639498 (-)
G1727529 NA non-coding upstream 46430 31645919 ~ 31646145 (-)
G1727532 NA non-coding upstream 63644 31663133 ~ 31663430 (-)
G1727535 NA non-coding upstream 74019 31673508 ~ 31673922 (-)
G1727354 NA other downstream 106844 31491520 ~ 31492302 (-)
G1726665 LOC103371314 other downstream 666330 30929350 ~ 30932816 (-)
LOC110500228 LOC106609233 other downstream 717754 30879517 ~ 30881416 (-)
LOC110500206 LOC106609206 other downstream 1649423 29937860 ~ 29952768 (-)
G1725623 NA other downstream 1712709 29885811 ~ 29886437 (-)
G1728665 NA other upstream 568180 32167669 ~ 32168934 (-)
LOC110500257 LOC106576032 other upstream 655358 32254847 ~ 32269661 (-)
LOC110500269 LOC106609159 other upstream 1003974 32603262 ~ 32604698 (-)
LOC110501068 LOC106575995 other upstream 2670322 34269811 ~ 34288000 (-)
G1730761 NA other upstream 2725736 34325225 ~ 34329576 (-)

Expression


G1727426(LOC107662719) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1727426(LOC107662719) Expression in each Bioproject

Bar chart with 18 bars.
G1727426(LOC107662719) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network