G1729442



Basic Information


Item Value
gene id G1729442
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 33295275 ~ 33295580 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1980921
AAGAAGCCTAGCATTCAGGGGTTCATCAGACAAACTCTTCCAATCAGATAATGGAAACTTCCTAAAAGAGGTTGAATTGCTAGCAAATTTGACCCCATTATGGAAAATCTTCTCAGCAAAATTAAAGATGGAGAGACACATGCTCATTACCTTGGGAAGCGCACACAGAATGAGCTGATATAGATTGTGAGTGACAAGATTCTGGAAGCAATAGTGACTCAAGTAAGAGACTCAAAGTACTTCTTCATCATCTTGGACTGTACACCTGACATTGGTCACCAGGAGAAAATGTAAATTATTCTGAGA

Function


NR:

description
PREDICTED: zinc finger MYM-type protein 1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1980921 True 306 lncRNA 0.39 1 33295275 33295580
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500280 LOC106609113 coding downstream 254467 33037901 ~ 33040808 (-)
LOC118942920 NA coding downstream 453330 32834421 ~ 32841945 (-)
LOC110500274 cssa07h12orf40 coding downstream 527436 32755608 ~ 32767839 (-)
LOC110500273 LOC106609119 coding downstream 605512 32679894 ~ 32689763 (-)
LOC110500931 LOC106609158 coding downstream 635577 32656979 ~ 32659698 (-)
LOC118942783 NA coding upstream 4636 33300216 ~ 33304366 (-)
LOC110501068 LOC106575995 coding upstream 974681 34269811 ~ 34288000 (-)
LOC118936404 LOC106575995 coding upstream 992496 34288076 ~ 34292270 (-)
LOC110500287 NA coding upstream 996486 34292066 ~ 34295197 (-)
LOC110500289 LOC106609155 coding upstream 1022692 34318272 ~ 34325044 (-)
G1729435 NA non-coding downstream 10359 33284689 ~ 33284916 (-)
G1729424 NA non-coding downstream 26120 33268680 ~ 33269155 (-)
G1729422 NA non-coding downstream 28587 33266455 ~ 33266688 (-)
G1729421 NA non-coding downstream 30743 33264332 ~ 33264532 (-)
G1729276 NA non-coding downstream 119780 33175277 ~ 33175495 (-)
G1729443 NA non-coding upstream 1773 33297353 ~ 33297606 (-)
G1729444 NA non-coding upstream 2460 33298040 ~ 33298317 (-)
G1729445 NA non-coding upstream 3653 33299233 ~ 33299533 (-)
G1729466 NA non-coding upstream 25821 33321401 ~ 33321679 (-)
G1729470 NA non-coding upstream 29030 33324610 ~ 33324895 (-)
LOC110500269 LOC106609159 other downstream 690645 32603262 ~ 32604698 (-)
LOC110500257 LOC106576032 other downstream 1025614 32254847 ~ 32269661 (-)
G1728665 NA other downstream 1126341 32167669 ~ 32168934 (-)
G1727426 LOC107662719 other downstream 1695786 31599146 ~ 31599489 (-)
G1727354 NA other downstream 1802973 31491520 ~ 31492302 (-)
G1730761 NA other upstream 1029645 34325225 ~ 34329576 (-)
LOC110500290 LOC106609105 other upstream 1076697 34372230 ~ 34376541 (-)
G1731156 NA other upstream 1261600 34555871 ~ 34565175 (-)
G1731328 LOC106609102 other upstream 1477886 34773466 ~ 34773878 (-)

Expression


G1729442 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1729442 Expression in each Bioproject

Bar chart with 18 bars.
G1729442 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network