G1729465



Basic Information


Item Value
gene id G1729465
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 33321453 ~ 33321761 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1980944
cctatgtgagaatgctgttcatcgactacagctcggcattcaacaccatagtaccctccaagctcgtcatcaagctcgagaccctgggtctcgaccctgccctgtgcaactgggtactggacttcctgacgggccgcccccaggtggtgagggtaggcaacaacatctccaccccgctgatcctcaacactggggccccacaagggtgcgttctgagccctctcctgtactccctgttcacccaagactgcgtggccacgcacgcctccaactcaatcatcaagtttgcggacgacacaacagtggtag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1980944 True 309 TUCP 0.58 1 33321453 33321761
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500282 LOC106609111 coding upstream 67930 33180674 ~ 33253523 (+)
LOC110501067 LOC106609112 coding upstream 154762 33054060 ~ 33166691 (+)
LOC110500281 trmu coding upstream 267946 33050475 ~ 33053507 (+)
LOC110500279 LOC106609114 coding upstream 363650 32841789 ~ 32957803 (+)
LOC110500278 LOC106609115 coding upstream 486495 32793210 ~ 32834958 (+)
LOC110500284 LOC106609109 coding downstream 8166 33329927 ~ 33515988 (+)
LOC110500285 fam19a5 coding downstream 387700 33709461 ~ 33869016 (+)
LOC110500288 LOC106609107 coding downstream 987338 34309099 ~ 34317797 (+)
LOC100135927 LOC106609106 coding downstream 1003449 34325210 ~ 34329578 (+)
LOC110500293 LOC106609102 coding downstream 1444959 34766720 ~ 34782583 (+)
G1729462 NA non-coding upstream 2407 33318824 ~ 33319046 (+)
G1729359 NA non-coding upstream 11709 33309524 ~ 33309744 (+)
G1729352 NA non-coding upstream 27506 33293708 ~ 33293947 (+)
G1729348 NA non-coding upstream 36208 33284691 ~ 33285245 (+)
G1729344 NA non-coding upstream 45186 33276047 ~ 33276267 (+)
G1729577 NA non-coding downstream 152074 33473835 ~ 33474330 (+)
G1729617 NA non-coding downstream 214116 33535877 ~ 33536136 (+)
G1729769 NA non-coding downstream 218183 33539944 ~ 33540150 (+)
G1729781 NA non-coding downstream 223717 33545478 ~ 33545693 (+)
G1729782 NA non-coding downstream 224139 33545900 ~ 33546114 (+)
LOC110500252 LOC106609149 other upstream 1159061 32153116 ~ 32162456 (+)
LOC110501063 LOC106609150 other upstream 1184757 32114413 ~ 32144886 (+)
G1727220 NA other upstream 1756859 31564135 ~ 31564594 (+)
G1727181 NA other upstream 1813081 31508056 ~ 31508372 (+)
G1727146 NA other upstream 1871336 31449396 ~ 31450117 (+)
G1732028 NA other downstream 2117528 35439289 ~ 35484354 (+)
G1732735 NA other downstream 2719570 36041331 ~ 36042488 (+)
LOC110500325 ppp2r5b other downstream 2911361 36189389 ~ 36237829 (+)
G1733187 NA other downstream 3435228 36756989 ~ 36760221 (+)

Expression


G1729465 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1729465 Expression in each Bioproject

Bar chart with 18 bars.
G1729465 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network