G1729923



Basic Information


Item Value
gene id G1729923
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 33658603 ~ 33658826 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1981426
ATGTAAGGCTCACAGCAGTTCTGACCAGACTCCAGGAGACTGGCCTGACACGCAATGAAAAATGCACCTTTGCACAGTCAGAGGTCTTGTTCTTGGGACACAAAATCAGTGCAGCTGGAATAGAGCCGGACCCTAACAATATCAGCGCCATCACAAATATGCTCATCCCCCAGAACGTGACTGAAGTCAGGACCTTCTTAGGCATGGCCAAATATGTGGGTAAG

Function


NR:

description
uncharacterized protein K02A2.6-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1981426 True 224 lncRNA 0.49 1 33658603 33658826
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500284 LOC106609109 coding upstream 142615 33329927 ~ 33515988 (+)
LOC110500282 LOC106609111 coding upstream 405080 33180674 ~ 33253523 (+)
LOC110501067 LOC106609112 coding upstream 491912 33054060 ~ 33166691 (+)
LOC110500281 trmu coding upstream 605096 33050475 ~ 33053507 (+)
LOC110500279 LOC106609114 coding upstream 700800 32841789 ~ 32957803 (+)
LOC110500285 fam19a5 coding downstream 50635 33709461 ~ 33869016 (+)
LOC110500288 LOC106609107 coding downstream 650273 34309099 ~ 34317797 (+)
LOC100135927 LOC106609106 coding downstream 666384 34325210 ~ 34329578 (+)
LOC110500293 LOC106609102 coding downstream 1107894 34766720 ~ 34782583 (+)
LOC118942784 NA coding downstream 1125587 34784413 ~ 34792564 (+)
G1729865 NA non-coding upstream 15391 33638251 ~ 33643212 (+)
G1729837 NA non-coding upstream 48608 33609688 ~ 33609995 (+)
G1729803 NA non-coding upstream 94473 33563862 ~ 33564130 (+)
G1729789 NA non-coding upstream 105117 33553224 ~ 33553486 (+)
G1729788 NA non-coding upstream 105400 33552977 ~ 33553203 (+)
G1730296 NA non-coding downstream 243821 33902647 ~ 33902885 (+)
G1730325 NA non-coding downstream 265990 33924816 ~ 33925079 (+)
G1730354 NA non-coding downstream 291666 33950492 ~ 33950910 (+)
G1730393 NA non-coding downstream 320528 33979354 ~ 33979570 (+)
G1729465 NA other upstream 336842 33321453 ~ 33321761 (+)
LOC110500252 LOC106609149 other upstream 1496211 32153116 ~ 32162456 (+)
LOC110501063 LOC106609150 other upstream 1521907 32114413 ~ 32144886 (+)
G1727220 NA other upstream 2094009 31564135 ~ 31564594 (+)
G1727181 NA other upstream 2150231 31508056 ~ 31508372 (+)
G1732028 NA other downstream 1780463 35439289 ~ 35484354 (+)
G1732735 NA other downstream 2382505 36041331 ~ 36042488 (+)
LOC110500325 ppp2r5b other downstream 2574296 36189389 ~ 36237829 (+)
G1733187 NA other downstream 3098163 36756989 ~ 36760221 (+)

Expression


G1729923 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1729923 Expression in each Bioproject

Bar chart with 4 bars.
G1729923 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network