G1732030



Basic Information


Item Value
gene id G1732030
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 35393921 ~ 35394210 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1983726
gagaagaaatgatattcacatcaaaagttacagcagtttaagtaagagcaccaagatcattttctgtaacattttggcaaacagtgtccattttgaccaatacgtcaacaagttagacaaaaagtcagagtgtatgggatatttgtctacttctctgctattcatagctgtgtgcagaatcaaaatattccatacggaacttacggtacagctgtttttgtaactgcattaccacgtgtttttcaaacttccacaaacaacgttcgttttgaccactttcggaacgtttt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1983726 True 290 lncRNA 0.37 1 35393921 35394210
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500296 LOC106609097 coding upstream 126121 35071370 ~ 35267800 (+)
LOC110500295 LOC106609100 coding upstream 360505 35029259 ~ 35033416 (+)
LOC110501070 wnt7b coding upstream 462750 34917692 ~ 34931171 (+)
LOC118942784 NA coding upstream 601357 34784413 ~ 34792564 (+)
LOC110500293 LOC106609102 coding upstream 611338 34766720 ~ 34782583 (+)
sh2d1ab sh21a coding downstream 109481 35503671 ~ 35510121 (+)
LOC118942786 NA coding downstream 242377 35636587 ~ 35637138 (+)
LOC110500322 LOC106609072 coding downstream 394281 35788491 ~ 35982905 (+)
sepsecs sepsecs coding downstream 605611 35999821 ~ 36039069 (+)
lgi2a LOC106609075 coding downstream 663906 36058116 ~ 36094464 (+)
G1732029 NA non-coding upstream 2038 35391594 ~ 35391883 (+)
G1731980 NA non-coding upstream 85416 35307582 ~ 35308505 (+)
G1731975 NA non-coding upstream 92318 35301084 ~ 35301603 (+)
G1731749 NA non-coding upstream 98001 35295534 ~ 35295920 (+)
G1731748 NA non-coding upstream 104386 35288851 ~ 35289535 (+)
G1732034 NA non-coding downstream 8736 35402946 ~ 35403714 (+)
G1732038 NA non-coding downstream 31001 35425211 ~ 35425999 (+)
G1732024 NA non-coding downstream 46514 35440724 ~ 35442473 (+)
G1732071 NA non-coding downstream 130256 35524466 ~ 35524815 (+)
LOC110500285 fam19a5 other upstream 1524944 33709461 ~ 33869016 (+)
G1729465 NA other upstream 2072160 33321453 ~ 33321761 (+)
LOC110500252 LOC106609149 other upstream 3231529 32153116 ~ 32162456 (+)
LOC110501063 LOC106609150 other upstream 3257225 32114413 ~ 32144886 (+)
G1727220 NA other upstream 3829327 31564135 ~ 31564594 (+)
G1732028 NA other downstream 45079 35439289 ~ 35484354 (+)
G1732735 NA other downstream 647121 36041331 ~ 36042488 (+)
LOC110500325 ppp2r5b other downstream 838912 36189389 ~ 36237829 (+)
G1733187 NA other downstream 1362779 36756989 ~ 36760221 (+)
zgc:109889 LOC100194703 other downstream 1854417 37248296 ~ 37314293 (+)

Expression


G1732030 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network