G1733116



Basic Information


Item Value
gene id G1733116
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 36610616 ~ 36610846 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1984895
gagatggcttcggcctttgtactgaactttcatccgcgcagggtggatgaggtagccggtgatgttcttctccttcagtgctttggcggcaggtctgaactgcttgcgacgtctggcgagatccgcgctcatatctgggaaaaggctgaccctctttccatcgatggtgatgtcccctttggctcttgcgagttgcagtatcttctctctgtcttggaaacggaggaacct

Function


NR:

description
hypothetical protein cypCar_00040603

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1984895 True 231 lncRNA 0.54 1 36610616 36610846
Loading

Neighbor


gene id symbol gene type direction distance location
si:dkey-183c6.8 LOC106609082 coding upstream 22576 36523371 ~ 36588040 (+)
LOC110500329 LOC106609084 coding upstream 152819 36426140 ~ 36457797 (+)
LOC110500327 NA coding upstream 203107 36405999 ~ 36407509 (+)
LOC110500325 ppp2r5b coding upstream 372787 36189389 ~ 36237829 (+)
LOC118942923 NA coding upstream 486693 36120516 ~ 36123923 (+)
LOC110500825 LOC106609032 coding downstream 55765 36666611 ~ 36756612 (+)
htr2cl1 LOC106609050 coding downstream 605359 37216205 ~ 37242879 (+)
zgc:109889 LOC100194703 coding downstream 637450 37248296 ~ 37314293 (+)
si:dkey-172j4.3 LOC106609052 coding downstream 819950 37430796 ~ 37537824 (+)
LOC110500311 LOC106609056 coding downstream 1038656 37649502 ~ 37656769 (+)
G1733115 NA non-coding upstream 119 36610294 ~ 36610497 (+)
G1733056 NA non-coding upstream 19737 36589563 ~ 36590879 (+)
G1733094 NA non-coding upstream 33722 36574336 ~ 36576894 (+)
G1733069 NA non-coding upstream 60723 36534834 ~ 36549893 (+)
G1732722 NA non-coding upstream 624346 35985967 ~ 35986270 (+)
G1733131 NA non-coding downstream 21918 36632764 ~ 36632984 (+)
G1733135 NA non-coding downstream 28627 36639473 ~ 36639697 (+)
G1733187 NA non-coding downstream 146143 36756989 ~ 36760221 (+)
G1733206 NA non-coding downstream 179388 36790234 ~ 36795077 (+)
G1733224 NA non-coding downstream 199442 36810288 ~ 36810676 (+)
G1732735 NA other upstream 568128 36041331 ~ 36042488 (+)
G1732028 NA other upstream 1126262 35439289 ~ 35484354 (+)
LOC110500285 fam19a5 other upstream 2741639 33709461 ~ 33869016 (+)
G1729465 NA other upstream 3288855 33321453 ~ 33321761 (+)
G1734420 NA other downstream 760111 37370957 ~ 37371667 (+)
G1734479 NA other downstream 954582 37565428 ~ 37568953 (+)
cited1 LOC106609035 other downstream 1149489 37758759 ~ 37765562 (+)

Expression


G1733116 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1733116 Expression in each Bioproject

Bar chart with 20 bars.
G1733116 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network