G1733831



Basic Information


Item Value
gene id G1733831
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 36869673 ~ 36869980 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1985700
cactgataatctccctcgatctggggctccacgcaagatctcaccccgtggggtcaaaatgattacaagaacggtgagcaaaaatcccagaaccacacggggggacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagtaacacattacgccaccagggactcaaatcctgcagtgccagacttgtccccctgcttaagccagtacatgtccaggcccgtctgacgtttgctagagagcatttggatgatccagaagaagattgggagaatgtcatatggtgagatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1985700 True 308 lncRNA 0.51 1 36869673 36869980
Loading

Neighbor


gene id symbol gene type direction distance location
syt4 LOC106609065 coding downstream 209927 36642784 ~ 36659746 (-)
ccdc166 ccdc166 coding downstream 345649 36519689 ~ 36524024 (-)
plcb3 plcb3 coding downstream 463086 36300905 ~ 36406587 (-)
LOC110500321 rpl34 coding downstream 1134017 35718993 ~ 35735656 (-)
LOC110500319 LOC106609071 coding downstream 1159784 35700548 ~ 35709889 (-)
si:dkey-171c9.3 LOC106609066 coding upstream 26830 36896810 ~ 36903172 (-)
gpr185b LOC106609051 coding upstream 456183 37326163 ~ 37332721 (-)
zgc:92429 LOC106609053 coding upstream 668007 37537987 ~ 37544697 (-)
si:ch211-200p22.4 LOC106609054 coding upstream 675161 37545141 ~ 37602616 (-)
LOC110500313 NA coding upstream 749846 37619826 ~ 37630426 (-)
G1733828 NA non-coding downstream 5799 36863557 ~ 36863874 (-)
G1733695 NA non-coding downstream 228131 36640778 ~ 36641542 (-)
G1733690 NA non-coding downstream 232223 36636872 ~ 36637450 (-)
G1733679 NA non-coding downstream 248370 36621088 ~ 36621303 (-)
G1733660 NA non-coding downstream 279318 36589555 ~ 36590355 (-)
G1733838 NA non-coding upstream 8076 36878056 ~ 36878453 (-)
G1733839 NA non-coding upstream 10007 36879987 ~ 36880202 (-)
G1733845 NA non-coding upstream 20832 36890812 ~ 36891101 (-)
G1733846 LOC100846954 non-coding upstream 21449 36891429 ~ 36891769 (-)
G1733969 NA non-coding upstream 102036 36972016 ~ 36992879 (-)
G1731966 NA other downstream 1574243 35292476 ~ 35295430 (-)
G1731967 NA other downstream 1577919 35291233 ~ 35291754 (-)
G1731917 NA other downstream 1624613 35213717 ~ 35245060 (-)
G1731328 LOC106609102 other downstream 2095795 34773466 ~ 34773878 (-)
G1734384 NA other upstream 464551 37334531 ~ 37334874 (-)
G1735116 LOC106609058 other upstream 896693 37766673 ~ 37772956 (-)
G1735425 NA other upstream 1326000 38195980 ~ 38196372 (-)
G1735740 NA other upstream 1656403 38526383 ~ 38526739 (-)
G1735742 NA other upstream 1657312 38527292 ~ 38527819 (-)

Expression


G1733831 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1733831 Expression in each Bioproject

Bar chart with 18 bars.
G1733831 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network