G1734201



Basic Information


Item Value
gene id G1734201
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 37179901 ~ 37180117 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1986079
ggacattagactggtgcaaatctgtcctttgatctgatctgagtccaaatttgagatttttggttccaaccgtcatatggtgcatggctgtgtgtttgattttatacacctgtcagcaacgggtgtggctgaaatagccaaatccactattttgaaggggtgtccacatacgtttgtatatacggtacaagtcaaaagtttggacacacctactcat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1986079 True 217 lncRNA 0.42 1 37179901 37180117

Neighbor


gene id symbol gene type direction distance location
LOC110500825 LOC106609032 coding upstream 423289 36666611 ~ 36756612 (+)
si:dkey-183c6.8 LOC106609082 coding upstream 591861 36523371 ~ 36588040 (+)
LOC110500329 LOC106609084 coding upstream 722104 36426140 ~ 36457797 (+)
LOC110500327 NA coding upstream 772392 36405999 ~ 36407509 (+)
LOC110500325 ppp2r5b coding upstream 942072 36189389 ~ 36237829 (+)
htr2cl1 LOC106609050 coding downstream 36088 37216205 ~ 37242879 (+)
zgc:109889 LOC100194703 coding downstream 68179 37248296 ~ 37314293 (+)
si:dkey-172j4.3 LOC106609052 coding downstream 250679 37430796 ~ 37537824 (+)
LOC110500311 LOC106609056 coding downstream 469385 37649502 ~ 37656769 (+)
LOC110500309 LOC106604291 coding downstream 521324 37701441 ~ 37703347 (+)
G1734197 NA non-coding upstream 840 37178776 ~ 37179061 (+)
G1734192 NA non-coding upstream 5510 37174072 ~ 37174391 (+)
G1733876 NA non-coding upstream 259538 36919970 ~ 36920363 (+)
G1733269 NA non-coding upstream 297555 36882053 ~ 36882346 (+)
G1733267 NA non-coding upstream 300228 36879220 ~ 36879673 (+)
G1734205 NA non-coding downstream 2288 37182405 ~ 37182622 (+)
G1734227 NA non-coding downstream 16496 37196613 ~ 37196945 (+)
G1734232 NA non-coding downstream 20069 37200186 ~ 37200425 (+)
G1733187 NA other upstream 421018 36756989 ~ 36760221 (+)
G1732735 NA other upstream 1137413 36041331 ~ 36042488 (+)
G1732028 NA other upstream 1695547 35439289 ~ 35484354 (+)
LOC110500285 fam19a5 other upstream 3310924 33709461 ~ 33869016 (+)
G1734420 NA other downstream 190840 37370957 ~ 37371667 (+)
G1734479 NA other downstream 385311 37565428 ~ 37568953 (+)
cited1 LOC106609035 other downstream 580218 37758759 ~ 37765562 (+)
G1734960 NA other downstream 862974 38043091 ~ 38045066 (+)

Expression


G1734201 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1734201 Expression in each Bioproject

Bar chart with 10 bars.
G1734201 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network