G1734319



Basic Information


Item Value
gene id G1734319
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 37235303 ~ 37235532 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1986205
tctctcgtctgatgaaaccaagattgaactcattggcctgaatcccaagcatcacgtctggaggaaacctggcacggtgaagcaaggtggtggcagcatcatgctgtgggaatgtttttcagcagcagggactgggagactagtcaggatcgaggcaaagatgaacggcgcaaagtacagagagaaccttggtaaaaacctgctccagagggctcaggacctcagactgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1986205 True 230 lncRNA 0.52 1 37235303 37235532

Neighbor


gene id symbol gene type direction distance location
si:dkey-171c9.3 LOC106609066 coding downstream 332131 36896810 ~ 36903172 (-)
LOC110500333 LOC106609048 coding downstream 355445 36795734 ~ 36879858 (-)
syt4 LOC106609065 coding downstream 575557 36642784 ~ 36659746 (-)
ccdc166 ccdc166 coding downstream 711279 36519689 ~ 36524024 (-)
plcb3 plcb3 coding downstream 828716 36300905 ~ 36406587 (-)
gpr185b LOC106609051 coding upstream 90631 37326163 ~ 37332721 (-)
zgc:92429 LOC106609053 coding upstream 302455 37537987 ~ 37544697 (-)
si:ch211-200p22.4 LOC106609054 coding upstream 309609 37545141 ~ 37602616 (-)
LOC110500313 NA coding upstream 384294 37619826 ~ 37630426 (-)
zgc:162171 LOC106609055 coding upstream 408170 37643702 ~ 37648915 (-)
G1734297 NA non-coding downstream 28501 37206577 ~ 37206802 (-)
G1734198 NA non-coding downstream 56524 37178516 ~ 37178779 (-)
G1734194 NA non-coding downstream 58901 37176012 ~ 37176402 (-)
G1734193 NA non-coding downstream 59993 37175074 ~ 37175310 (-)
G1733969 NA non-coding downstream 242424 36972016 ~ 36992879 (-)
G1734366 LOC106609034 non-coding upstream 64152 37299684 ~ 37308251 (-)
G1734380 NA non-coding upstream 87361 37322893 ~ 37324868 (-)
G1734405 NA non-coding upstream 117402 37352934 ~ 37353286 (-)
G1734419 NA non-coding upstream 133307 37368839 ~ 37370374 (-)
LOC110500321 rpl34 other downstream 1499660 35718993 ~ 35735656 (-)
G1731966 NA other downstream 1939873 35292476 ~ 35295430 (-)
G1731967 NA other downstream 1943549 35291233 ~ 35291754 (-)
G1731917 NA other downstream 1990243 35213717 ~ 35245060 (-)
G1731328 LOC106609102 other downstream 2461425 34773466 ~ 34773878 (-)
G1734384 NA other upstream 98999 37334531 ~ 37334874 (-)
G1735116 LOC106609058 other upstream 531141 37766673 ~ 37772956 (-)
G1735425 NA other upstream 960448 38195980 ~ 38196372 (-)
G1735740 NA other upstream 1290851 38526383 ~ 38526739 (-)
G1735742 NA other upstream 1291760 38527292 ~ 38527819 (-)

Expression


G1734319 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1734319 Expression in each Bioproject

Bar chart with 14 bars.
G1734319 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network