G1734587



Basic Information


Item Value
gene id G1734587
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 37689867 ~ 37690069 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1986498
GCACTTAGAGTATTGCTATATTCTCCTAAAAGAAAGGTTGTGATTGTGATCCAGAAACTCTTCACCATTTATTTTGGGACTGTTCTTATGTCAGAACATTTTGGAGTGAGTTAGATTTTATTTGAAAAGAAACAACTATTGATATTGATCTGAGAGACTCTGATATTATGTTTCATTTTGATCCAACTGATATGGACTTAACT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1986498 True 203 lncRNA 0.32 1 37689867 37690069
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500311 LOC106609056 coding upstream 33715 37649502 ~ 37656769 (+)
si:dkey-172j4.3 LOC106609052 coding upstream 152043 37430796 ~ 37537824 (+)
zgc:109889 LOC100194703 coding upstream 378627 37248296 ~ 37314293 (+)
htr2cl1 LOC106609050 coding upstream 446994 37216205 ~ 37242879 (+)
LOC110500825 LOC106609032 coding upstream 933255 36666611 ~ 36756612 (+)
LOC110500309 LOC106604291 coding downstream 11372 37701441 ~ 37703347 (+)
hdac8 hdac8 coding downstream 31049 37721118 ~ 37757590 (+)
cited1 LOC106609035 coding downstream 68690 37758759 ~ 37765562 (+)
rs4x rs4x coding downstream 76585 37766654 ~ 37772954 (+)
LOC118943013 NA coding downstream 78073 37768142 ~ 37768217 (+)
G1734585 NA non-coding upstream 3064 37686566 ~ 37686803 (+)
G1734551 NA non-coding upstream 31139 37658221 ~ 37658728 (+)
G1734553 NA non-coding upstream 32557 37656945 ~ 37657310 (+)
G1734550 NA non-coding upstream 69486 37619947 ~ 37620381 (+)
G1734588 NA non-coding downstream 844 37690913 ~ 37691131 (+)
G1734743 NA non-coding downstream 6690 37696759 ~ 37696991 (+)
G1734745 NA non-coding downstream 9349 37699418 ~ 37699937 (+)
G1734762 NA non-coding downstream 26828 37716897 ~ 37717213 (+)
G1734479 NA other upstream 120914 37565428 ~ 37568953 (+)
G1734420 NA other upstream 318200 37370957 ~ 37371667 (+)
G1733187 NA other upstream 930984 36756989 ~ 36760221 (+)
LOC110500325 ppp2r5b other upstream 1453602 36189389 ~ 36237829 (+)
G1734960 NA other downstream 353022 38043091 ~ 38045066 (+)
G1734961 NA other downstream 355039 38045108 ~ 38046506 (+)
LOC110500301 LOC106609063 other downstream 387482 38076983 ~ 38083972 (+)
arrb2b LOC106608931 other downstream 1177898 38867935 ~ 38939119 (+)

Expression


G1734587 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1734587 Expression in each Bioproject

Bar chart with 5 bars.
G1734587 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network