G1735740



Basic Information


Item Value
gene id G1735740
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 38526383 ~ 38526739 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1987788
ATTTCCAAAGACGCATGTCCCAGCTGTTGGATGGGCTGAGTGGCGTCATAGTCCACGTGGACGATGTGCTCGTGTGCGGAAGGGACAGAGCAGAACATGATGTAAGGCTCACAGCAGTTCTGACCCGACTCCAGGAGACTGGCCTGACACTCAATGAAAAATGCACTTTTGCACAATCAGAGGTCTTGTTCTTGGGACACAAAATCAGTGCAGCTGGAATAGAGCCGGACCCAGAGAAGATCAGCGCCATCACAGATATGCCCAAACCCCAGAATGTGGCTGAAGTCAGGACCTTCTTAGGCATGGCCACATATGTGGGTAAGTTCCTCCCACAGTTCTCAGATACAACCAAACCTC

Function


NR:

description
uncharacterized protein K02A2.6-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1987788 True 357 TUCP 0.51 1 38526383 38526739

Neighbor


gene id symbol gene type direction distance location
LOC110500828 LOC106608900 coding downstream 20407 38503806 ~ 38505976 (-)
LOC110500339 LOC106608922 coding downstream 231698 38202424 ~ 38294685 (-)
LOC110500304 LOC101154659 coding downstream 457676 38048002 ~ 38068707 (-)
LOC118942924 NA coding downstream 585831 37939012 ~ 37940552 (-)
LOC118942925 NA coding downstream 587542 37937435 ~ 37938841 (-)
LOC110500347 cd99l2 coding upstream 216338 38743077 ~ 38769087 (-)
LOC110500353 NA coding upstream 412318 38934413 ~ 38943112 (-)
LOC110500358 LOC106608936 coding upstream 507757 39034496 ~ 39059624 (-)
ache LOC106608940 coding upstream 558885 39085624 ~ 39121383 (-)
snapc2 snapc2 coding upstream 627631 39154370 ~ 39158799 (-)
G1735738 LOC105902936 non-coding downstream 78 38525997 ~ 38526305 (-)
G1735737 NA non-coding downstream 620 38525553 ~ 38525763 (-)
G1735734 NA non-coding downstream 2272 38523903 ~ 38524111 (-)
G1735731 NA non-coding downstream 3482 38522654 ~ 38522901 (-)
G1735726 NA non-coding downstream 9373 38516745 ~ 38517010 (-)
G1736544 NA non-coding upstream 29363 38556102 ~ 38595077 (-)
G1736571 NA non-coding upstream 80828 38607567 ~ 38609083 (-)
G1736596 NA non-coding upstream 177703 38704442 ~ 38707861 (-)
G1736663 NA non-coding upstream 246714 38773453 ~ 38834668 (-)
G1736667 NA non-coding upstream 277530 38804269 ~ 38818284 (-)
G1735425 NA other downstream 330011 38195980 ~ 38196372 (-)
G1735116 LOC106609058 other downstream 753427 37766673 ~ 37772956 (-)
G1734384 NA other downstream 1191509 37334531 ~ 37334874 (-)
LOC110500321 rpl34 other downstream 2790740 35718993 ~ 35735656 (-)
G1731966 NA other downstream 3230953 35292476 ~ 35295430 (-)
G1735742 NA other upstream 553 38527292 ~ 38527819 (-)
LOC110500374 LOC106609020 other upstream 1045097 39571290 ~ 39579548 (-)
G1737209 NA other upstream 1251217 39777956 ~ 39778850 (-)
LOC110500404 pea15 other upstream 1693741 40220480 ~ 40285714 (-)

Expression


G1735740 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1735740 Expression in each Bioproject

Bar chart with 20 bars.
G1735740 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network