G1736042



Basic Information


Item Value
gene id G1736042
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 39103955 ~ 39105859 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1988147
GTGTTGGAAAGAGGGAGAGCTTGAGGAAAAAAACTGCGGGGCTTGATAGTATTTACTAAGCAGATATTTACTAAGCATGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGATATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTACCCTAGCAGGTATTTACCCTAGCAGGTATTTACCCTAGCAGGTATTTACTAAGCAGGTATTTAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1988147 True 489 lncRNA 0.38 3 39103955 39105859

Neighbor


gene id symbol gene type direction distance location
zgc:92664 LOC106608937 coding upstream 81091 39003738 ~ 39022864 (+)
alox12 LOC106608934 coding upstream 117722 38969383 ~ 38986233 (+)
LOC110500354 LOC106608903 coding upstream 136078 38956139 ~ 38982550 (+)
arrb2b LOC106608931 coding upstream 164836 38867935 ~ 38939119 (+)
hmgb3a LOC106608930 coding upstream 239425 38857116 ~ 38864530 (+)
LOC118942927 NA coding downstream 32683 39138542 ~ 39154522 (+)
nat16 LOC106608942 coding downstream 73288 39179147 ~ 39211035 (+)
LOC110500362 LOC106608944 coding downstream 122789 39228648 ~ 39237917 (+)
nat16l LOC106608945 coding downstream 139972 39245831 ~ 39256597 (+)
LOC110500364 LOC106608946 coding downstream 217006 39322865 ~ 39331908 (+)
G1735932 pelp1 non-coding upstream 148554 38943178 ~ 38955401 (+)
G1735820 NA non-coding upstream 434032 38669409 ~ 38669923 (+)
G1735795 NA non-coding upstream 475803 38627784 ~ 38628152 (+)
G1735784 NA non-coding upstream 494830 38607190 ~ 38609125 (+)
G1736065 NA non-coding downstream 37851 39143710 ~ 39144316 (+)
G1736093 NA non-coding downstream 85583 39191442 ~ 39191854 (+)
G1736133 NA non-coding downstream 190203 39296062 ~ 39302368 (+)
G1736154 ap1s1 non-coding downstream 234779 39340638 ~ 39362957 (+)
LOC110500301 LOC106609063 other upstream 1021681 38076983 ~ 38083972 (+)
G1734961 NA other upstream 1057449 38045108 ~ 38046506 (+)
G1734960 NA other upstream 1058889 38043091 ~ 38045066 (+)
cited1 LOC106609035 other upstream 1340697 37758759 ~ 37765562 (+)
G1736098 NA other downstream 127805 39233664 ~ 39289670 (+)
G1736484 LOC106608963 other downstream 769897 39875756 ~ 39876950 (+)
G1737353 NA other downstream 956847 40062706 ~ 40063325 (+)
LOC110500409 LOC106599480 other downstream 1295645 40401452 ~ 40404840 (+)

Expression


G1736042 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1736042 Expression in each Bioproject

Bar chart with 7 bars.
G1736042 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network