G1738532 (LOC100380853)


Basic Information

Item Value
gene id G1738532
gene name LOC100380853
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 40909854 ~ 40910618 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1990994
gggtgaccgcattagggccgtgcgtaattggccgactccgaccacggtaaaggaggtgcagcgttttctgggttttgccaactactaccggaggtttatccggggttttggccaggtagcggctcccatcacctcactgctgaaggggggcccggtgcgtttgcagtggtcagcagaggcggacggagcattcaacaagttgaaggcgctgtttactgatgcgcccgtgttggcgcttccggacccctctctagcattcatagtggaggtggacgcgtccgaggctggggtgggtgccgtgctatcacagcgctcgggtacgccaccaaaactccgaccctgcgctttcttctcaaggaagctcagcccagcggagcgtaactatgatgtgggggaccgggagttgctagcggtggttagagctctgaaggtgtggagacactggcttgagggggctaaacacccctttctcatctggaccgaccaccagaatctggagtatattcgggcagctaggagacttaacccacgtcaggcaaggtgggccatgttcttcacccggttccgatttactttgtcttatagaccaggctcccagaacgtgaaggctgacgcactgtcccgcctttatgacacggaggatgggtccaccgaacctactcccatccttcccgcctcgaagctggtagccccagtggtatgggaggtggactcggacatcgagcgggcgttacgggctgaacccgcgcctcctcagtgtccagc

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1990994 True 765 TUCP 0.59 1 40909854 40910618
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110500836 LOC106577997 coding downstream 66478 40840523 ~ 40843376 (-)
LOC110500835 LOC106608986 coding downstream 117342 40763080 ~ 40792512 (-)
si:cabz01007807.1 LOC106608985 coding downstream 150932 40748424 ~ 40758922 (-)
LOC110500416 LOC106608984 coding downstream 174496 40717312 ~ 40735358 (-)
si:cabz01007794.1 LOC106608983 coding downstream 209181 40689960 ~ 40700673 (-)
LOC110500421 LOC106608988 coding upstream 16362 40926980 ~ 40947169 (-)
si:ch1073-220m6.1 LOC106608989 coding upstream 42217 40952835 ~ 40960487 (-)
LOC110500423 LOC106608990 coding upstream 85917 40992854 ~ 41012581 (-)
capn1 capn1 coding upstream 148686 41059304 ~ 41100666 (-)
LOC110500433 LOC106608999 coding upstream 336434 41247052 ~ 41322224 (-)
G1738531 NA non-coding downstream 1106 40908277 ~ 40908748 (-)
G1738523 NA non-coding downstream 51586 40858055 ~ 40858268 (-)
G1738522 NA non-coding downstream 52058 40856547 ~ 40857796 (-)
G1738514 NA non-coding downstream 64306 40845201 ~ 40845548 (-)
G1738361 NA non-coding downstream 395271 40493727 ~ 40514635 (-)
G1738533 NA non-coding upstream 1003 40911621 ~ 40912096 (-)
G1738534 LOC106612182 non-coding upstream 1596 40912214 ~ 40912560 (-)
G1738638 NA non-coding upstream 191587 41102205 ~ 41102548 (-)
G1738650 NA non-coding upstream 216454 41127072 ~ 41127299 (-)
G1737718 NA other downstream 530176 40270818 ~ 40379678 (-)
LOC110500404 pea15 other downstream 624268 40220480 ~ 40285714 (-)
G1737209 NA other downstream 1131004 39777956 ~ 39778850 (-)
LOC110500374 LOC106609020 other downstream 1330814 39571290 ~ 39579548 (-)
G1738673 NA other upstream 251502 41162120 ~ 41162803 (-)
G1739063 NA other upstream 862227 41772845 ~ 41773455 (-)
G1739712 NA other upstream 1442830 42353448 ~ 42353861 (-)
nelfa nelfa other upstream 1731538 42642148 ~ 42654789 (-)
LOC110500482 LOC106608856 other upstream 2129402 43039949 ~ 43041554 (-)

Expression

G1738532(LOC100380853) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1738532(LOC100380853) Expression in each Bioproject

Bar chart with 20 bars.
G1738532(LOC100380853) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network