G1740100



Basic Information


Item Value
gene id G1740100
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 42817437 ~ 42817844 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1992782
attgaacacatttatggagattttacactattgtggagagatgtactgtttggattctttacatacaatagaaataagcggaatcatttttatgtaattaatttcattattcttttggccaaatttcatatacacaaatgtaaatttacaaacagaaaaccacattttcgtaccctacaaaaataaattgaactgtattttaagacggttaaatgctctactaacaaaaaagctgttagaattgtaagtatatgcatgtcccttaaggtccttgtgtaattgtaatgtgatattgtaccccctagctcgattgtctattgtttgtaatctatgtatgcttgtgttccctcatgtgctttatgtattgatttgatattaataaaaataaaacaattaaaaataaaaagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1992782 True 408 lncRNA 0.28 1 42817437 42817844

Neighbor


gene id symbol gene type direction distance location
LOC110500477 LOC106608861 coding upstream 16889 42790604 ~ 42800548 (+)
LOC110500846 nat8l coding upstream 127158 42676945 ~ 42692054 (+)
c21h4orf48 cssa07h4orf48 coding upstream 156342 42655361 ~ 42661164 (+)
faah2b LOC106608863 coding upstream 176156 42633393 ~ 42641281 (+)
LOC110500468 LOC106608867 coding upstream 231224 42569232 ~ 42586213 (+)
LOC110500479 LOC106608859 coding downstream 3871 42821715 ~ 42834094 (+)
LOC110500480 LOC106608857 coding downstream 184842 43002686 ~ 43034963 (+)
gmpr2 LOC106608854 coding downstream 223922 43041766 ~ 43055080 (+)
LOC110500484 LOC106608853 coding downstream 240668 43058512 ~ 43062374 (+)
tinf2 LOC106608852 coding downstream 256441 43074285 ~ 43079143 (+)
G1740099 NA non-coding upstream 74 42817164 ~ 42817363 (+)
G1740098 NA non-coding upstream 298 42816883 ~ 42817139 (+)
G1740097 NA non-coding upstream 2345 42814781 ~ 42815092 (+)
G1740095 NA non-coding upstream 5237 42811884 ~ 42812200 (+)
G1740051 NA non-coding upstream 66959 42750217 ~ 42750478 (+)
G1740101 NA non-coding downstream 1242 42819086 ~ 42821075 (+)
G1740103 NA non-coding downstream 18300 42836144 ~ 42838760 (+)
G1740127 LOC106608858 non-coding downstream 42002 42859846 ~ 42860278 (+)
G1740131 NA non-coding downstream 45851 42863695 ~ 42863924 (+)
G1740134 NA non-coding downstream 48874 42866718 ~ 42867152 (+)
G1739440 vax2 other upstream 315080 42501349 ~ 42502357 (+)
si:dkey-185m8.2 LOC106608874 other upstream 462110 42354556 ~ 42370239 (+)
cxcl8c cxcl8c other upstream 528937 42285056 ~ 42288500 (+)
G1739103 NA other upstream 919581 41888811 ~ 41897856 (+)
G1738119 NA other upstream 1788301 41024710 ~ 41029136 (+)
G1740312 r1441 other downstream 437809 43255653 ~ 43327738 (+)
LOC110500499 ubil other downstream 449370 43267057 ~ 43268143 (+)
G1740366 LOC106608832 other downstream 571345 43389189 ~ 43390299 (+)
G1740398 NA other downstream 629206 43447050 ~ 43451167 (+)
G1740412 LOC106608825 other downstream 651974 43469818 ~ 43470325 (+)

Expression


G1740100 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1740100 Expression in each Bioproject

Bar chart with 18 bars.
G1740100 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network